Sorex_araneus Locus Poly:9:SNORA71
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:9:SNORA71
Sorex_araneus
Poly:9:SNORA71
scaffold_229507
SNORA71, SNORA71
1001..1131, 1687..1820
2820
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGGCTCCTGCGAGG
CCCTGCTGTGGAGCTGCAACTGTGCGCTTCCCCCAGCCCCTGGACATGGCAGCCCTCTCC
CCTTTCCTGCCCGGTGTTTTTCGGGGCCTCCCCCTGCCTCTGCTGGGCCTGCACTCAGTG
CTGTGACCTGTGACCGCCTCCTGCTGGTGGAACAGCCGTGCTGCCAGGGCCAGTCTCGGG
CTGAGGGGCCCTGGGCACCCGGGTCACCTGGGGCTCCCAGTGGTTCCTCTTAGGGAGCTT
GGCCTGCTGGGCGTGAGGGTGAGGGACACGTGTGCCCACCTGCGGGCCACCCTTCTGTCC
CTACTAGAGGTCACTGCCTTGTGTGGGGGGAAGGGTGGACGCTGAAGGCCTGGGCAGGAA
GCTCCTTCTGCACCCCCGGCTGCTGCAGTGTGTTGGCTCAGCCGGCATGCGGGGCCCGTC
CTGCCCGGCATCTCCCAGCTGGGCTGTGTCCTGTCGCCTGTGCCCTTCTGGGGCTGCTCC
CTGTTTGCACTCAGAGCCCTGCCTCCCGGCCTTTGAGACCCACTTTTTCTATTCCTGTGT
TTGGGGAGCACGGCTATGGTGGTGGCCACGTCGGGGGTCCTGAGGTAGGTCGCGCTGACT
CCAGTCCCTGGTGCCTGCTTGTCCCTTGCCGACCCTTTGGCCCCTGTATTCGAAAGTGAT
CGCTGGCTGCCTGTGCCCCGGTCATTGATAGTGCAGGGAGAGAAGTTGATGAAAGCCTTT
CCCCGTGTTTGGGGGGTCTCCTGTCCCTTCCAGACCCTGGTGCTTTCGTACAGTCTGTCC
CACGCTGCTCCCTGCCAGGTGCTCCCAGCCCACAGGGTGCAGCCACTGCCCTCCAGGGTA
TCTCTTGCAGGTGGGGGCGTGTGTGCAGATGGCCCAGGAAGGCTCTTTCTCGACGACCCA
CGATGCCCAGGCACGGGTGCCCCAGGTAAGGCTCTCGGCTGTGCTTCCCCGGCGTGGGTG
TGCGGTAGCTAAAGCATCTTCTGGGGCTCGGGGGAGGAGTCGGGAGTGGGTCCCCAGTGG
GTCCTGTTGTGGGTCAGTCCCTCTGCGGCTGAGACCCCACCATGGCCACCTGCCCTCCTG
CCAGCACAGCTGGGACAGTACTCAGCCGTCTCTCTCTGGGTTTGGTCTCTGGGCTGGTTC
TGGCGGGTCTGGGGTGACCTTTGCACTGTCCCTGCCCGGCCCAGTCTGCTTGAAGCGACA
GCCTTGAGCCGTGCTTGACCCCAGCCCACTTCTCCGTCTGGACTCGTGGCAGGGAGGCGG
GACGGGGCCTTCGTAGCTGTTAGAAGCTACTGTGCAGGAGCTCCTCCTTGCTGCCCTCGT
CCTCTGCTCCTGCATCCGAAAGTGGTCGTGGCTGCCTGTGCCCTGGCCATTGGTAGTGCA
GGGACAGGAATCGCGGGAAGGCGTTTTCCCCGTGTTCGGAGGGTCAGCCCTGTCCCTCCC
GAACCCTGAAGCTTCCCCACACTCCGTTTGGGGTTGGGGGTTTGACCCGGCACTGCAGCA
CGTGAGGTGCACGTGGGAGGCCCCGATTCCACCCCCGCACCGGCGCTGGAGCGAGTGCAG
CGGGGAGGGCATTTGCCCCGCAGGCGGCCAACCTGGGTTCCATCCCAGTCCCCCCATGGT
GGTTCCCCCAGTCCTTCCAGGAGGATGTGGCCCCCAAACAGAATAAACAATCAGCCAATC
CCCAGCACCACTAAAAGGGAAATCCGCACTGGCCTGCTTTTCTCCCACATTCCTTCGGGG
CGGGCCTCTTGCCGCCTTTGTGTTTCCTGCACGGTCCCGGCAGTGGGGCTCTGTCCTGCC
ATGGCTGTGGGGGCCTCCCTCTGGAGCCGGCTCAGGAGACGCCGTGAGCTCTGCCGGCCA
CTGCGAGTCGGAGGGCGATGGCTCCTCCAGGGCTGCCGGTGCCGGAGTCGGGGGTGGAGC
CCAGGGGCCCACGGGCACAGCGCCCGCTCCAGTGCTCAGAGCCACCCCTGCTCCAGCTTG
TTTGTTCGGGATTGAACACGGGACTTCTCGTGAATGGGAGAAAGTGCAGGGGGTGGGCAT
CAGGCAGAGGGGAAGGGGTGCGCTGACTCTGCCCCCCGCCCCCCCCGCAGGCAGTGCTCC
CGAGCCTGTGGGAATTGCGCCTTGTTTTGGGGCCATGGCCAGTGGTGCTCAGGAGCCCTG
GGTGCAGGGTGGGGCCAGCCTTCAGCCCTTGGCGCTGTCTCCCCGGGCCCCGGGCTGTTG
TTTCTCTTTAGGACGGGGGGAGGCCACCTTGTCCGGCGGGCCGTGGGCTGCTCGACGTTG
GTGACTGACTTGGGGAGGTGTTTGGCGTGTGCCCCCACCATGACTGCAGCTTTGGAGTGT
CCTGTGGGTCGCTGTGTGTTGTTCTCGGGTGTTGATGGCGCTGTCCCTGTTCCGCTCACC
TTTCAGGTGGACCTGACCGGCCTGAGCCCCAGTGACCTGGTCAGCTGGCGAGTCTCCCGG
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved