Sorex_araneus Locus Mono:608:SNORA66
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:608:SNORA66
Sorex_araneus
Mono:608:SNORA66
scaffold_5471
SNORA66
1001..1135
1988
CTTTTTGGGTCATACCTGGCGATGCACAGGGGTCACTCCTGGCTCTGCACTCAGGAATT
ACCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCCGGGTCAGCCGC
GTGCAAGGCAAACGCCCTACCCGCTGTGCTATTGCTCCAGCCCACAACTAATGATTTTTT
TTACCACTGTACCACCACTGACATCCTGTTGCTCATTGATTTGCTTGAGCGGGCACCAGT
AATGGCTCCATTTTGAGACTTGTTACTGTGTTTGGCATATTGAATTACCCACGGTAGCTT
GCCAGGCTCTGCCGTGCGGGCGAGATACTCTCGGTAGCTTGCCAGGCTCTCCAAGAGGGG
CGGAGGAATCGAACCCGGATTGCCCACGTGCAGGGCAAACGCCCTACCACTGTGCATTAT
TTAAATTTTTTTAATTGAGTCACCGTTACAAACCTACTTGGTATCAATCATACAGTGATT
CAACATCTACCCTCCACCAGTGTCCCATTTCCTACCCCCTCCCTCCCCACAGCTGGCCAC
AGCTAATGTTGGTGAGCATGTGATGAGGAAGGAATCTTAGCCCACTGCTGGGAATGGAAA
TTGGTGTGGCCTCTGTGGAAAATAGTGTGGAGACTTCTTGGTTCAAAAGACGCAGATACC
GTAGATGTGGATATACTCCTCTCCATTTATCTGAAGGATATGAAAACACTAATCCGAAAT
GACTTTCACCTGGTGTTCAGAGCATTATTCACATAGGCAGGGATCAGCGTTAAGGCCCAT
TGACAGGTGACTGGATAAGGAAGTTGTGTATACTCCATGGAATACTACTCTGCTGATAAC
AAAAAGGTGAAATTGCACAAACCAGATCTCTAACTCTGCATGATATTGCAGAAGTGAGGG
GAACCAGGTATGCTAAAGTAACTGCAGTGATAGAAATGGACTAACTTAACATATTATACT
GAGGAGCCTATTTTAGTACAAGATTTTTAAAAAAAGATCATTTGGAGCCAAATGGATGAA
ATGTGAGATTTTGCTGAATGCAGTAAGGCAGTGAAAGAATCTAGATAGTTCGACTCATGT
GGAATGCAAAGTAGTAAGACAAATAAAGTTGAAAAAGAAAAGGGCAATGAAATTAACTAG
GTGAATGAAAACTGGTGACTCCCATAGGGGTGGGGTTGGAAGGAATTGGCCTTTTGGGAG
TTGTTTGGCATGGGAACTTTGTAGTAGGTGTAGTTAATATTGCACTCAGGTGGGAATGAT
AAGCTTCACCATTGATATTATGTTATATTGTAAACTAATGAGAAATCAGTTTGAAAGAGT
TATTCTTCTTCTCCTTCTCCCCCACCTTGTGGGATAAGCAGCGCCTGGAAATGTATTCAT
AGTAGCTTTACACCCAGTGATGCTCAGGGGTAACTTTTGGCTCTGCGCTCAGGAATTAAT
CCTGGTGGTGCTCTGGGGACCATATGGATGCCGGGGATCGATCCTGGGTCGGCCGTGTGC
TAGGCAAATGCCCTACCCACTATTCTATGATTCCAGCCCGGTTTTATGTTTTTACAGCTT
TTGAAAACCCACGTACTCAAATTAAAACGACTAGTCACCCTTTTAGAAATGCTTTGATTT
TGTAGTACTAGAATTCTTTGCTAAGTGATTGTAGGGGAAACTCTTCGCAGGTTAGAAGGT
TTACTTTTTTTCTGCTTGTTTTCTGGGTCAGCAGGCAGGTCAGAAAATCAAGCAGGGGGT
TGGGAGGAAAAAGACCTCTGTCCAATTCTAGCTGTGTTGACCTTGGACAAGGCAGCTTTC
CTATTTTTCATCTGAACATTAAATGTCATGATGGCTGGCTCCATGCTACACAGGGTTTGC
TGTGTGTCAGGCGAGGTCTCAGGATGGATCGGTGTCTGCTGGAGGCCGCACAGATGTTCT
CACAGAGAGGATAGAGAGAGGAGAGAGAGAAAGAGGAGAGAGGAGAGAGGAGAGTGCAGG
AGGTAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved