Sorex_araneus Locus Mono:243:SNORA57
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:243:SNORA57
Sorex_araneus
Mono:243:SNORA57
scaffold_165845
SNORA57
1001..1148
2148
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGAAATTATTCCTAGAGGTGCTTAGAGGACCATGTGGGATGAAA
ACAGATCAAACCTGGGTCTGTAGTATGCAAGGTAAATGCCCTACATGCTGTACTATCTCC
CTGGCCCACAATTTTCAAAAATTTTCTTTTATTGTAGTATTTTTTTCATAATTATATTTG
TAATTTAGTTGTAACAAGTAATATGAAATGAGTTATTTTGTTTCTGCTAAGAGGGCAGAC
ATGGAAAGTGTTTGGTGGAAAGAAGGTCAATGGTGCTGGGACTGGTGTTGGAACACTGAA
TGCCCATAACAACTGTACTATGAGTAACTTTGTAAACTATGATGAGTAGCTAAAGAAAGA
GACCATTAATATATTTTTAAATGTGAACATAGTTACAGCTTCTGAAATATCACCATAAAT
CTGTATTTATTGCTTAACAAGGGACATGGGGACATGAGAATCTCCATATCAGATTAATTA
TTTGCTATTTCCATTTCTCTGCTGACTTAAAAAAAGTGCAATGTTAATTAGAATGTCTGA
TGTTGGCACTTTCACGTCATCACTCATATAAGTTCTTCCAGATCTTTGCCATTCCTTAGC
AGAATAGTGCCTTCTCCCACGACTCCTGTCCAGGATTATATAAGAATTTACTGCACTTAG
ACAAAGGATATTTTTATAAGACATGTAGAGGAAAAAATAGTAGAAACTTAGATCTCAAAA
TAAGTTATTAAACTCAAAGTAGAATATAAAATGAATTCCTGCTTATAAATCTGAGTAGAA
TTTCAGGTTTGAAATTTTATCAAGAAAGGTAACACCCGTACCCTCCTTTTCTTGGCGGGT
ATCGGGCGTGCGGTCCGATGCCCGTAATGTTTGGAGGCAGAGGGCAAGGGCGCCTCGCCC
CTCGGCGTCATGTCTTCGGTGCCGGCAGCTTGCCATCCGCCGGTTCTATCCTCAAGCGCC
GGGATACGCTACTGCAGCAGGGCGGACGGGACGGGCTCGGCGGGCACCTCCTCCTCGGGT
CCCCTAAACACTCTCCTCTTACCATTAAAAAGAAAAAGAAAAAAAAAGAAAGGTAACACC
CAAAATGCATCATGTATCCCTTTTTATATCTCAGATAATGAAACAACTTGAGGTCTTATC
TCTTCAGCAACCAACCCAAATAGAAAAGAATGTGATTAAAGAGAAAACAATATAATATTA
AAAACAGGGTACATTTCTGCCTCTGAGCATGCATTGAATTTATTTGAAATGGAATCCAGC
CTGTTCACTGGAACACAGTTAAGATTTTACTTGAAGAAGTATATGTCAGTGCTATTTTTC
AGATATTCTTTTGAGAGTTGAGCTCTTCTATGTTGAAGAAATATTTAGTTTAATAATTAT
ATGTTTATTCTTATCATCATCTGTTATTTTTCAATTGTGAGAACTTCCTTAATGACACAC
CATGTTTTATACATTCTGTAATGACATACAGGACGTTTAGCATAAGAAAATCAGCAAATG
ATGAATAATCATCATTAAAAAGGTGATTTTATAAAAATAGTCTTTATTGTTCTGTATATT
TTTACTTCTATTGCATATTGATTTAATTTAATTTTACTTCTATTGCATATTGATTTATTT
AATACAGGGTAAGAAAGGGAGAGTTATAAAATACTGCTTGTGTTCATTGGCACATCGATG
GTGATCATGGTGTGGTAATATACTCCTAAAGTATACAAACATCTACACTCACATAAATCA
ATTGTGCCTGTTTTTTAAAAAGTCTTTTTTAAGTTGGACCAGAGATATATTATTCTGGAG
AAATCACGTATCTTGCATACAACTGCCCTGAGTTTGATCTGTGGCTCCTCTGACTGGACA
CCATCAGTAGAGATCCCAGTAGTTCAGATCCGGGACTAAGCCCTGAGCATAGCCAGCATC
AAGGTGTGGCCTAGCTCCCTGCCTCCTCTGAAAATAAAGTAGAATAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved