Sorex_araneus Locus Mono:815:SNORD89
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:815:SNORD89
Sorex_araneus
Mono:815:SNORD89
GeneScaffold_4615
SNORD89
1001..1110
2110
CTGATGAAACACACTTTTATTATTTTTTTCCAGTAGCTAAAGGGGCTGACTTTTAAGAA
CCCTGTGATAAATCAAGGTAAGTTGGTTTTGTTGGTTTTTTTTGTTGTCGTTGTTATTTT
CTTTTTGGGTCACACCTGGCAATGCACAGGGGTTAACTCCTGGCTCTGTACTCAGGAATA
ACTCCTGGTGGTGCTCGGGGGACCATGTGGGATGCTGGGGATTGAACCCGGGTGGCCGTG
TGCAAGGCAAATGCCCTACCTGCTGTGCTATCGCTCCCACCAAGGTAAGTTGGTTTTGGT
CATTAGTGTGCTTTGGGGGGCGGGGGGGAGGCCGTCGCACCTGGCGATGCTCAGGGGTTC
CTTCTGGCTCTGCTCTCTGTGTTACTCCTGGAGGTGATCAGCGTCGTGCCCACTGTGCTG
TCTCTCGGCCGCTTTCATTCTCCAGTTTTCATGAGTGCTAGAAGGGGGCAGCTAGGCCCC
AGCCCGCAGTGCTGGTGGGAGATGGAGGTGCCCAGCCACTGGGACTGGTCTCTAGCACCC
AGGAGGAAGATTCGCTTCGGGATCATCACAGCATCGCCGAGGCCCTGGGTCCGAAGCTCG
CAGCACAGGTGCTCCAGCTCCAGCTGTTGAGTTTCCTTTTCCTTTTTTCAAAAGTGTGAA
TTGCGAGTGCAGACAGCGGAAGCAGCAGAGCCTCGTCTCCGGAAACCTGTCTCCACTAGC
AAGAAAGTAAATTAGCGACGGTACGTAGAAAAAGTTTACTCAGACAAAAAAAAAAGGAAA
CAGCTGAGAGTGTTTCGAGGCCCGTAAGGTTGGCGGCAGGTGGGGTACAGGGGTGGAGAG
AGCAGGTGCATGGGGCAAGCCATGGCTGTGTGGACACGTGGCAGTGACCACCCCCCCTCT
GCAGGGCTGCTTTGCCGCGCCCCAGCCCTCCTGGCCCTGTGCGCCTTGCTTGTCTGTGGC
GGGCGCAACCCTGGTGAGTGCAGGAGAGAGGTCCGGAGGTGGCCGAGGAATGATGACAAT
AAAAGGCCGAATTGCAGTGTCTCCCCAGCAGTTGGCTCTCTGGGTGCACGATGACAAAAC
CCCCCGAAGCGAACCCCATTCTGACCTCGGCGCCGTCAGGGCCCAGTTCCAGGGTGTCCA
TGCACTGCCGGGCTCCTAAAGGGACGCTCAGCGCCCTGTCCCCTCCCCACACAGCTGGGC
TGAGATCACTGCGGGTGGCCCCTAAAACAACGGCTGTGTTTAGGAGCGGGTTTGTTTCTA
TGTGGATTACCCAGTTGTAACCAAAATTTTCTGCAAGAAGGCTTTTTAAAAATGTTTTTA
TTTTAAGGACTTCTGTAGCGGTGCCCTGGATCCACCCGGGCCTCACACAGCTCTTCTGGG
GCACTGGCCCAGAGCCACACAGCAGCACCGAGCCACAGGCAGCCCGGCCCTTGCCTCTGT
GGCAGTGGAAATCCGTCTTCTCCAGGGAAGTTGAGGCCACACGCTCTATCTTGAGTTGGT
CTCTGCAGCCTCGTGCAAACCCTGCTTGGTGGGACGTTGGCCTGAACCAAAACCAACGCG
GAGGGAGTTCCCGAGGTGCCACTTCCACCTTTCCCAGCTGCAGCGTCTCCTGTACAGACA
CCAGAATATAAGAGGCTCCGTGTCTGCAGAGAGCCGCCGTGCGTGCGGCATGTTGTCCTT
GCTATGGAGAAATACAGCGCGTTCATTTCAAGATTACATTAAAAGCTGGGCCGTTCTGGA
TGAGTTGTAGCTTGTGTCCTGCAGGTTGCCCGGGTACCAGGGCTCCCTGGGGTGGTTTGA
CGGTCACTGGACACTTGAGGGTCAGCCTCCATAGTGGAACGACTGGAGGTGATGGGGACA
GGTGTGGAGCATGGGTAGGCCCCACCCCACACCTGGGGACCAGGTGTCTTAGAGGGTCTA
AGAACCTTAATGAGCAAAAATAAGATTTATGAACCATCAAGTGTACTCAAAATCCCATTG
AAAATAGGGAAATTATAACCCGGTGCCACATCAGGATTTTCAGGACAGGTCTCTGTGCGC
CAGTTGGTGTCTGCAGACGGGCTCCAGTCCTGAGACATGCCACTTCCCCAGAGTTGTTTA
AGTCACCTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved