Sorex_araneus Locus Poly:13:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:13:SNORD116
Sorex_araneus
Poly:13:SNORD116
GeneScaffold_2779
SNORD116, SNORD116, SNORD116
1001..1093, 2369..2469, 3087..3187
4187
ATTCCGGAATTCTGCCTTTGGAATCAGAAGTTCTGTGTGATTATTTGAATATTTTTGCC
TGTCAGTCACTATGCTAAATATTTTGCTTTTAACCTGTGGCATGATGATTGTAGATATTT
TCTCTCTTAATGCCAGTGATATAATGATGGCATCTGTTTGAGGTTGTAGGAATGAGTCTG
GCTGGAATGAATTCTCTTGTTTTTGCATTTAGCTGTAAGAGTTTTGTTGGTATCCGTCTG
CCTCTACCCTCATATCAGTGTAATACAAGTACTGTGATTTGCACTATGGTTATTTAACAC
TAATAAGCTTTTAAGTTGCTTATTAGTGATAGGTAAGAGAAAATAGCATACCATGCAGAT
GTAATTCTTGAACCTGTTTGTAGATTTGATTCTCTTTTTCAGGTTCCTGTGTTCTTGATT
TGATTCTCTTTTTCAACTTCCATAGTCATGATTAAGTTGCTTTCTTTCTGGAGTTAAATA
TCTACTTTCACTGATAATTGAATTTGCTTGAAAAACATGAGAAGAATATGGGTCAGGGTA
CACCTTGGCATTCAAAAGAATACTGGAGGTAAGCATTCCTGACTTATTGGCTCTGCTCTC
CCTTGTGGATGTTCTCATAATATCAGAGTTGCAGTGAGTACACGTGTACTGTACTGAGAT
CATTTAGGTTTCTGTTTTATTTTTTTTATTTTTATTTTTTTTTTGCTTTTTGGGTCGCAC
CCAGCAATGCTCAGGGGTCACTCCTGACTCTGAACTCAGGAATTACCCCTGGCCATGCTC
AGGGGGCCATATGGGATGCTGGGAATCGAACCCAGGTCGGCCGCATGCAAGGCAAACGCC
CTACCCACTGTACTATCACTCCAGCCCCTAGGTTTCTGTTTTAGAATAAATAGACTCAAG
CCCAGTCCTAGGTATTGTATAGCCTCTGAGTTTATTGATTCACTTGCCAAATACCCATTT
TGTTTTGATATAAGTGAAAGGGTAGCCTCCCTGAATTTGTTGGATCGATGATGATTCTCC
CAAAAGCATTCCTTGGAAAGCTGAACAAAATGAGTGAGAACTCAATACCGCCGTTCTCCT
CGACGCTGAGGTCCAACAAGTTCTTTGACAAGGAATTGTAGCCATTTGTCACATTGTTTC
CTTGGCCTTCTCTTTAAAGTTACTCTTATCACGGGGTCTTTTCCTTCCTTGTTTGCTAAA
GCAATGGGAACTCCCACAGCAAAGGTTTTAATTGTACACATGTGGTTGAAGTGCCTCTCA
ACATGGGGTTAGTAGATTTAAGTCATGATAAGTGTACAAGTGACTCCTAGTGATGATGTT
GTTTGCTATTCTATCACTCAATTACTGCTTTGGAGCGATAGCACAGCAGTAGGCATTTCA
TGCAGCCGATTCATGGTTGATTCCTCCCACCCCTCTCGGAGAGCCTGGCAAGTTACCGAG
AGTATCGCCCCTGCACCGTCAGAGCCTGGCAAGCTACCAGTGGCATATTTGACACGTCAA
GAACAGTAACAATAAGTCACCCAATAAGAGACATTATTGGTTCCCACTTGATCAAATCTA
TGAGCAACGGGATAACAATGATAGAGACAGATTTAGTAACTAAGTTGAGTTTTTATATTG
TGGACTAGTAGTCCTTAAACGGATGACATACCTCTACCCATGTGAATTTGCTAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCGCCGCGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCGCTCCAGCC
CCCATGAATTCTCTGACTTTTGAGGTCACTGGCTTCATTCTACTAGACCAGGCCAGCTGC
TTGAGGGAGGCAGTATCTATACTGTTTGTGAATCAATGATGAGTACTCTTAACTCTATGC
ATTCTTTGGAAAACCTCAACAAAATGAGTGAGAACTCACACCACCGCTATTCTCATCATA
TCTGAGGTCTAGCATGTGGTCTGTCTCATGGATGGAGGCATGAGGGACACCTTTACCTTG
GTCAGATACATTCACCAACACCCAGGAATTTGTTTCAAAGGTACTTGGCACTCCACGGCT
TATGTCTATGTTTTCTGTGGAGGAGTCAAGTATCATCATCCATAGAAGGACTTGCAGATT
TTGCCACATTTTTAACTACTTATGGTCAGTCCCCCATTCCTGCAATCTGATTTTATGGCT
ATTTGTTTGTAAAGGCAGTTCCAGGCCTGCCCACTTGGATACTGTAGTTATGATCTCTTA
TGCCTATTTCCTGGGTATATTCTTATGTGTTTTAATTTTTTGTGTATACTCCTCAGGTGG
AATTTTCTTTCCAACGTCTTCGTAGATCAAGAAGAGCTTCCTGTTTCGCCACAGTAAAAC
TGATGATCTAGCCAAATAAAAAAAAAAAGATTTGTTTGCTCTTGTGCCACAGACACTTCC
CTAGAGTAAGTTGATAATCATCCAATAGTTCTTCTGCTGTGCTTTATTTTGGCCTCTCTT
AAAACGTGCTTGAGGACCCATTCTTCAAGCACATGCACTACTGTACCAGTCCTTCTGCTT
ATGTTAACTAGCCTCCCAACTGTGCTCGGATCGATGATGAGTACCCCTACCTCTATGCAT
TCCTTGGAAAACCTGAACAAAATGAGTGAGAATTCCCACCACCGCCGTTCTCATCGTATC
TGAGGTCCAGCACGTAGTCTGCTCAATGGACTGTAGTCCTAAAGGAGAGCTTCCCCTTGG
TAACACTCATGCACCGCCACATGACTTTCTATTTAGGCACAGCAAATGAATTGTCGTCCT
GAGGTTGTTGGGAAGTTAGGGAATCTTGAATCCTCGGCAGCATCTGACTCTCATCTGGTC
CTGGATGAGTCAGCAAACATGTTGCCATAGGAAGACATTGTCTTTTCTTCACTATGGGCC
ACTGGACAGAAATAGTGTATTCATGTGTAGAAACCATGTTGGTTTTGTGGACTTGTAATT
TTTGGAAGGGATTGGCATTAGATTGTATAGATGTACGCACCGGAGTGTTCGCCTTGGTGA
TTTCCATACTGGACACCATATTGAGAATTGTGGCTATAGAAGAATGTTAACGGCTGGATC
TTATTTGTAAATTCTTGTTGTTTCCCATTATTATTCCCAGTGGGTATAGTGAATGTTTAA
GCTGATTGTGAGGCCTACAAGGTCTTATATGTCTCTTTTGTCCTAGATATACGATGACAC
TGAAACAATATCACTGTGGGTGATTGTTATCTCTCCATACTGTATTTCCTATGTCCATTT
TATATTCATGCATATGTCTGTTCAGTTTTGCTATGATGGCATCCATTTGTGTATTTTTTT
TTTCGAAATCTTGTGGATAAGAAGTATATGCTATACCTTCCTATTGGTTCTTAGCTAGCT
AGCACTATTTCTGGACTGGCAGGTATGCACATTCTAACGTCTTTCCGGATCTAGGCTTCT
GAGATTTTTGTTAAGTGTAGAGAACCCTTCATAGTGCATGAATGAGAAGCTGGGATTCAA
TGTGTCTTATATTGTTTGGTGCCATCTCACCATTGCATCTTTAAGAGGCACAGCTCATGG
CAAATCTGATCAGAATTTGTTAGCTTATTTTGTTACAACTCATTTGAAGAAAGATGAAAC
ATGCCTTGCTTTGTTGGCAGAAACTACTCTTAAAGGGAGTGGGTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved