Sorex_araneus Locus Mono:664:SNORA9
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:664:SNORA9
Sorex_araneus
Mono:664:SNORA9
GeneScaffold_6716
SNORA9
1001..1132
1387
GAGGTCGCTGCGTGGGAAGGGACGGGAATACCTGACCTACGGACAGTCTACCTTATTTG
GGGTCGTCCCGGAGGACTGGCCTGGCGTGGGCCGGTGGGGGAAGGGAAGCCGCGTGAGGA
AGAATGCAGGCCCTGGCTCTCGCCCACAACACAAACCACGTTTTGGGCTCCCGAGCTGTC
AGGCAGGAAGGGGTCTGCTCTCGGGAACCGCCCGGGGCCCTGAGAAATCGGCTGTCGTGC
CTCAGATCTCAGCCCCCTGCAAGCCTCCAGCGTGCTGGCGTCTGGAGTGACCCTGTGCAT
TCCTACAGTGCTTGCAAGAACATTATGAAATAGTTTGAGGCCTTGCCCGGCTGCATCCAG
AGCAAGGCTATAGAAATTTCAGACAAATGAAAGAAAAAAAAAATCTCAATCCCACTGGAG
ACTCAATCCCCTAGATTATAGAGCTAATAATTAGGAAATCTGAATAATTAGAACATCTGA
AATGAGAGCTGATTTGTCACTCTGGCCTCATCGCTGACTTTGTGGGAAAGTGACTTAACC
AACTCTGTTCCTCCTTTTAAAAAAAAAAAGTGAAGATAAACGACGCTGTTCAATGCTGAC
GCTTAGTGAAAGCGCACATCTGTATTAGCAATAATGCCAGTTGCTCATTTTGTGCATGAG
TGGCAGAACACCACTTTATGGACACATGCTGGGGACATAGTGTTCTGATTGCAGCATTTG
CCTTCTGTGTAACTGTGAAGAACTCCTGAATGGAAACCAGTCTTTTAATTTTTAGATTTT
GTCATTCTGTGTACGTGCTATTTCCACCAGCGTTTGTAAAAGTGAATAATTGAATGAATG
AAGGATGTAACCCAACAACATGGACAAGTCAGTGAAGTGGGGTAGAACACAATAATGCCC
TTTAGGGCAAAGCATCTATCTGTATCTATGTCAAGAGATATCAGTTACACTGTTCCGAAA
TTTCACATAGAGCTGTGAATGTAAGCCTTGAATTGAATCTCCAGGTATGAAAACTGAACA
GTATACAATAGGAAGTGAAGTACAGGTCCTGGTGGCCAAATTGACAGGGAAGGTTCTGGT
GAAGAGTGGGTCACTTGAGACTTGTTCTCCAAGCCCATATTCTCCTTTGAACATGTGTCT
CACTTGCTTATCTCTGTAGCTCAGCTTTTTCCACTCAGAAGAACTCATGTTATCTCTTGA
CAGGTACTTCCTCTCTTTCTCTCCACTTATGTCTTTCTAAGTAAGCTTCATTCAGTACAA
ATTATCTTGTTTCACTATTTCACCTCCTCCTGAAATTCATTTCTGTGGGGAAAGGAGACA
GCTGAAATACCTGTGCTGAGGTTAGGACTTCCCCGATCTAGTCCAAGCATTTCCAGGCAG
GTGGGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved