Sorex_araneus Locus Mono:475:SNORA53
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:475:SNORA53
Sorex_araneus
Mono:475:SNORA53
scaffold_137878
SNORA53
1001..1244
1575
TTATCACAGAGCTAGAACAGCCCTAAAAATTTTGCAAGGAGATAGATAGTACAGCAGGT
AGAGTTCTTGCCTTGCACATGGCTAACCTGGGTTTGATTCTCAGCACCCGCTATGGTTTC
CTGAGCCTACCAGGAATGATCCCTGAATGCAGAGCCAGAAGTAAGCCCTGAGGACCACCA
GGTATGGCCAAAATACACACACACACACACACACACACACAGAGGTACATGCAGCATACA
TACACACACACACACAGAGGTGCATGCAGCATACATACACACACACACACGTGCATGCAG
CATACACATCAAAAAAACTAAGAGGAATTTTGAGAAGAAAAAAGGTTAAGACTTTACAGT
TTTGTTTTTTCTTTGAGGGGCGGGGTGGAGTGTTGGGTTTTTTGTTTTTTGAGCCAAACT
TGCCAGTGGTTTGGAGCTAGCCCTGGCTCAGTGAGGGGATCACCCCAGGCTGCCTCAATG
CAAAACATGCTCTCAGGCTCTTGGACCAGCTCTTTGGATCACATCTTCTGTTGTAACCCA
AACAACATGATCTAAAAACAAATAAAAACAGGGGCTGGAGAGAGAGCACAGAGGCTAAGG
AGTTTGTTTGCCTTGACCAGCTGACCTGGGTTTGATCCCCAGCATCCCCCTGGGGGATGG
GGGAAAGTCATTAACAAAACAAAAACAAACAAACACACACAGATCAACAAAAAAACAAAC
AGAAAGTCTAGAAATGGCCCCGAGAGAGGCAAAGGGCTGGGGCATGTACTGTACAGGCAG
GAGCCCAGCTTTGATCCTCAGCACCTGCTGGGTCTCCTGGGGGGGGGTCACCATCCCAAA
AAGAAAATTTCAGGCATACATATATAGCCAGTTCAGTTATGATAAAATGCCTAAAATGAT
CATATTTGCTAGAGGGTTAATATAAATATACATACATATATACACATATATATGTATATA
TACCCTTGTACAATTCAGGGATGGAGCAATAGTGGATAGGGTGTTTGCCTTGCACGTGGG
CCTACCTGGGTTTGATTCCTGGCATCACATATGGTCCATCGAGCCTGCCAGGAGTTATCC
ATGAGCAAAGAAAGAAAGGAAGGAAAAGGTTATATAGTCAAAGGTGCCTGAGTCATTGGC
ATGTGAGATCAATATACCTGCATGTTAGTCTTAAATCCTGATAGAAATGACATGCAATTA
TGCTGCCATTCTTGACTATCAGGACCTGACTGTTGTGTGGACACTAATGTTGAAAATTTC
TGCTTGGCAATGGCAGAAGTTAAATCTCCTATAGTCTATAGGGGGATTATGTAACGTAAA
AGAAATAGAATTTAGGACCTCAAGGAATAAATGCTTATTTACCTCTTTATTGAAAAAAAA
AGGAAGGAAGGAAAAAAGGAAGGGAAGAAGGGAAGGAAGGAGGAAGGGAGGGAGAGAGGG
AAAGAGAAAGAGAGAGAGAAGAAAGAGAAAGAAAGGAAGGAAGAAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGACAAGACAACGAGAAGAAAGGAAGGAAGAAAGGAAGA
AGGAGAGAAAGAGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved