Sorex_araneus Locus Mono:7:SNORA63
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:7:SNORA63
Sorex_araneus
Mono:7:SNORA63
scaffold_252465
SNORA63
1001..1131
2131
CCAACAAGACTCTGCTCCCTCTATTCCTAAGAAATGCAGTTCTCCAGTTACACCACCGT
GAAATGTGACCTTTCTTTCCATCTGGCACTGAGGTTTAGGCATAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTTGACCTCCCCCTTCAAATTCCCCTC
TGAAATATGATTGAGAGCTTATATAAAACTGATGTTTAGTGAGAGTATAGGCTATTAAAG
CGTGAAGTACAAGTATTGGATACATGTTTGACTTGCCTGACTGGACTCTGAGTTGTGTCC
TTCAGAAGATGGTCCTCAAAAGGATGATGATATCAGTGGTTAGGGACTGTTAACCACTAG
TGAAGTTTTTTATTTATTTTATTTATTTTTTAATTGAGTTACCGTGAGAACAGTTACAGG
GCTTTTACGATCGAGTCTCAGTCATACTATGCTCAAACACCCATCCCTTCACCAGTGCAC
ATGTTCCACCACCAAAAACCCCAGCATACCTCCCCTTGCCACTCCCCCTCTGCCTGTGTG
GCAGATTATTTTAGTGAAGTCTTTTATTGTCCTAGTGTAGCAGAATTAGAGCCAATGCTG
AAAAAAAAAGAGATGGAATTCATTTCTTCATATAGGGCTTCATTAGAACTGTTAAAAGAA
ACAGAGACTTTGGGGTGAAATTTTTCATTACAGGAAAGATCAAAAGACAATATATAATCA
AGCTATCATGAGTGACTATACTAGATGACCTCAAACTTCTCTTCAGGCTCCAGAATTTTA
TTCCAGATCCCCAAGCAAGACATACTTAGACTTAGATACACTAATGGGGTTTCTTGTTCT
GAGAGCACTATCCAGTTTTTCTAGCCTCTCTGAGTTTTTGTATATATATTCCTTCTACCT
TTGGATATCAACATACCAAACATTCATTAAACATAGGAAACAAGAGGATTTTAACTACAG
TATAGAATATAAAGGTTGTGCTGTTGGTCCCCCTGCTTTAAATAAAATTGTTTCTTAAAT
GTACCTGTCTGCTTGACTCCTGTTGCAGCCAGGGATACTTGGTCTCATAGATGTTAAAAA
GGAAAAAAAAATAAGTGGGGAGCATTTCCTCTCCATAACTGTATGTCCATTACCCACCCA
AGATCTGTAGCATATAGTCAATTCTCAGTAGATATGTGTTAAATGACTAGATACTTTGTT
ACCTAATACCTTGCAGGTGCCTTCCCTAAAAACCCATCCCACCTAGAAATATTTTAACCT
CAGATACTTTACCTTGCTCAGTAATACTATTTTATGGGCCTGCAGTTCCTTTCCCACCAA
AGAAGTGCTCCCAATAGAACACTGGTTCATTCAGGTGCTGTATGTGGCAATACTTGTGTG
CCAAACCACAGAGAAATCTTTAGGCTCCAGGAGGCTAATTTAGGCTAAACTGACACTTGC
TAAGGCTGTACATGCTTAAAATGTCACTAAATGAGAGTTAATAAATCTGTTTACAGAAAA
ATTATCTTTATAACAACCATCTCCATAATTCAGTTTCTCATTTTAGCTGGGGTGGACTAA
GTTCTCACTTAAAATGATGATGGTAATACTAAGGATAACTTTGCCCAAAGTGCCCCCACC
CCAAGAGTAAACCCATGGGCATTACATTCATTTCAAAAATTCTCTGAGTGTCTGCATGAT
ACCTTGCTAAAATATTTCCTGCAACTATCCTCCGGGCTTACATGGAATAAATCAGAAAAT
TAAATGCATATGTGGGCATCAAACCAGGACCTTTAATTAAAATGAGATAGTTTAACCTTC
CCGATGAGGTGAAACCTTCCATTCATTTGCACTACTGATATAGTATCACTGTGTCACTGT
CATCCCGTTGTTCGTCGATTTACTCGAGCAGACACCAGTAACTTCTCTATTCCTCTGAGC
CCTGAGATTTTAGCAGCCTCTCCTTACTCATCTTTCCCAATGATTGGAGGCACTTTCAGG
GACAGGGGAATGAGATCTATCGTTACTGTTATGGGCTTATTGAATACGCCATAGGTAGCT
TGCCTACTGATATAGTATACATAGAAATTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved