Sorex_araneus Locus Mono:326:SNORA72
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:326:SNORA72
Sorex_araneus
Mono:326:SNORA72
scaffold_248858
SNORA72
1001..1152
2152
CTAGATTTTTCCTTTTGGGGGAGACTTTTTTATTACTTTTTTATTACTTTTATAACTTT
TTTATTTACTTTTTTAGATAACAAGTATTAAAAGCCCTAAATATTTTACCTTAAAAAATC
TTTTATAAGAAATGAACATAAGGTAAAGTGGCAGGCTACAAAATAAATACATAAAAATCT
ATTACATTCCTATATGGGATGATGAATAAGAAAACAATTTCTCTTATAATTGCTTTAAAA
AAATTAAATACCTAGGAACAAACTTTTAAAAAGTAGTGAAACACTTAATATAAAATAAAA
ACTACAAGACACTACTAAAAGATAAAAAAAAATGAGACAAAAAATGAATGAAAGGTATGT
CTATGACTAGGTAAAATTAAGACAGTGAAAATGTCCATCTTGGCAGAATCTCCTGCCCCC
ACACCAGGCTGTCTTCACCGGGGCCCCTCAGAGGAGGGCAGATTGAGTTTTCCTTCTCAC
ACCAAGCAGAGCCCCGGCAGCCAAAAACCTCCAGAACCCAGCCACAGCCATGCTCAAGGC
CACTCTTCACACGCTCGGATGAGCCTCACCCATGAAGGAACCGACAGAGGAACCCAGTTA
GGCGGGACCCATGGCTGAGATCTCCAAGCCTGCTCGGATCGGGACTGGGCTTCCTCCACC
CAGATCCCCTGTTTTCCAGTAGCTTGGCAGTCACACCCACAAACTGCCCCGGGCGCCATG
TAATCTCATCAATGGCCAAGATCCAGAGACTATAAAACATAGCTCCCAGAAGAGAGGGAT
GCAGAATCTGGCATGGCAGAGCCTGGCAATCTACCTGTGGCATATTGGATATGCCCAAAA
CAGTAACAATAATGGTCGTCATTCCCCTGACCCTGAACGTGACAGGGATGAATGAAGATG
TTACTAGTGCCCACTCGAGCAAATCAATGAACAAGGGGACGACAGTGATACAGTGATATA
AAACTTTATATTTTGATGTATATACCAAAAGGAATAAGACACTGCAAATATTATCATTGT
TCTGATTTTGTAATAATTGGGGTAGGCTAAACATTTGCATGTGTCCATGCATGTGTAAGT
AAGATCACACTTGTGTCCTCAGACCTAGTTCTTTACCTACCTAGGTCTGAGCTTAGAAAT
GGCTGAGATCTCCAAGCCTGCTTGGATCGGGACTGGGCCTCCTCCATCCATATCCCCGGT
TTTCCAGTAGCTTGGCAGTCACACCCTCAAACTGCCTCCGGCACCATGTAATCTCATCAA
TGGCCAAGATCCAGAGACTATAAAACAAAGCTCCCAGGATGAGAGCGATGTAGAATCTCA
CACAGCAGAGCCTGGCAAGCTACCTATGGTGTATTCAATATGCCTAAAACAGTAATAATA
ATGGGCTTCATTCCCCTGACCCTGAACGTGACAGGGACAAATGAAGATGTGACTGGCCCC
TGCTCAAGCAAATTGATGAGCAACAGGATGACGGGTGATACAGGTGAAATCATAACTAAA
ATGCGTTACCATTGAGAGCAGTAAGGGAATAATTAAATATGCCGAGGAGGAGCCAGAATG
GGCATAAGAGGTGTAAGTGAGAAACATTGTTTGATTCTTTGGGGACCACACCCAGCTGTG
CTCAGGGATTACTCCTGGTTCTGCACTTGGGGATCGCTCTTGGGGATCTTATATGGTCTC
ACAATTCCTATTTCTAGTCACAGAATTTCCTCACTGTCATCACCAAGTTACTTTTTCTCT
TTTTTTTTTGTTGGTGGTGAACCTAATAATCTGATATTTCCAAAAGAAAAGAAGTGAAGT
TACTTGGGATAGTTCTTGTTTCTTTGGAATTTTTAGAGTGGAACCATCTTCTTAAATATA
CATGGTGTTTGACTAGAATGTTCTTAAACTAAGTCTGGGCTGGTATAACTGGAACTGAAT
TGTCTTGCATCCTCTAACATAGCCTTACTCATATGCCCTAGGCCTCAGACTTGGGTTACT
TTTCACCGACCTCTCACCTCTCAGAGTGCTAATCCACACATGCTCCCAAGGTCAAACATG
GGTCCAGAAGAAAGAGATGACAGGCTCCAACCAGTGTGCAGATATGTTTTTCAAGCCCTA
GCATGCCGTGTTTGGCTAGTATTCCATTGCTCACAGCAAGTCTCATCAACAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved