Sorex_araneus Locus Mono:822:SNORD17
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:822:SNORD17
Sorex_araneus
Mono:822:SNORD17
GeneScaffold_883
SNORD17
1001..1239
2239
GGGAGGGGCATTCCCCAAGTTTCCACAAAGAAAGGCAAGGGAATATTCAAAGGATGTCA
TTGTAATCTCAGTGTCGAAGTACTCTAGTATTAAATCAGGGACCTAGTTATTATAGTTTC
AACTCTGGGGTGGGGGAGGAGGTTATCAGAGCACTCATAGATAAACTGAAATCTGACTGC
ATTTATAGAAAATCTTAAATTGGATGTCTTGTATTTGGAAGAGGCACACCCAAGTGATCA
AAACCCAGAGCTGAAATGGGGTCAAATCTCAGGCTTCCACATAGAAAGCAGTTTTCAATC
CTGGTCCCCGGTAGATCACCCGCCGCCAAAATAGTGTTGGAATGACCTTCACTATTCTGG
CCATGTTTGGTGTATTTGGTTCTTATGTGACTTAAGTTTTTGTTCTTTTCATAGAACATG
TACTGAGTTCCTGATAAACTTTTAATTTTCTTTTTGTGTCACTGGCCGATGCACAGGGGT
TACTCCTGGTTTTATACTCAGGAATTAATACTGTGGTGCTCAGGGGACCCTCTGGGATAC
TGGGAATCGAACCCCTGTCAGCCACATGCAAGGCAAATGCCCTACCCCCTATATTATCAC
TCCAGCCCCCTGATAAACCTTTTTTAAGAAAGGGGGAGATGGAATGAACAAAGCAGGTGG
TGTCGCTTCCATTCACTCCCTAAGGTGTTTTAGGGGGATCTTGTGATGCTGTTGTTTGAA
CCCAGGCCTTCTTGAAAGCAAAAGCAAGCCCTCAGCCCATTGAGATTTTGCTCAGGCCCC
CAAATTTAGTTTCTCTTGCATCTCTTTTCTCTGTGTGGCAATTCCCACTAAGATTTCTAT
ACTGTGAAGTTACTAGAGGTATGTAGTTCAACCCGTTTGTTTTGTGAACTCAAAATAATC
TAGGTATCTAAGAGTTAGCTGGTTTTCTTGCGATATTATTTAAGGCAGTAATTTAATCCG
TTGGATTTCATATTGGGATTTCTTCATGGACTTGCAGCCTTGTGAAATGATGATTCAGTT
TATCCATTCGCTGAGTACGCAGTCACTGATCTTCTTCCAAGCCTCAGTTCCCGTTCTGGG
AACCTGAGTCTACGCAGCCTCCAGTTGCCTTGCCTTGCAGTCTGTAGTGTTCTACTGTGG
ACAGCTTGTGTGTTGGTGGCTGCTGGTAAGATGGTTGGTGTCAGCAGGGATAGGTCCTCC
GGGTCCCATCTCACTAAGATGAGTGGTGAAATCTGATCACTTGCTGCACAGCCCTGTGGA
ATTTTTTTTTGGTTTTTGTTTAAACTTGAATGTTAGTAAACTTAAGGTATAGAAGTCTTG
GTTCTATTCCCGTGAAGGAATTGAAGTGAAAACAGCCAGATACTGGAAGGGAAGAGACCA
GAGACTTTGGGGCTGGAGGAGTAGAAAGAAAGCTCTTGAAACACTTTGCTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved