Sorex_araneus Locus Mono:396:SNORD60
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:396:SNORD60
Sorex_araneus
Mono:396:SNORD60
scaffold_208285
SNORD60
1001..1083
2083
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGAATCGCTCTATGTTGCAGATCGGAGTCTGGTTGGCGCTG
GGAAGCGGTCGCTCACGCTGCGGCTCAATGGCCTCGCAGAGTGCAGAGCCTCTGACTCCT
GGCTGGAGCGGAGCGTATCAGCGGCAGACAGGGGGCGGTACTTCTAGCGGCACTGCCCAA
TCAGAGACGAGAGCACTTCCTATAAAGGCTTGAACTTGCCGCCGAACATTCTTTTCGGGA
TCCTGCTCTGAGTCGCTGTGTGTGTCCGTGCAGCGCTGCTAGAGAATTGTCGAGCTGGCC
GTGGGCCACAGAAGAGTCGCCTGGCCCCGCGGGTCAGCCAGGTTGCCAGGGCCAGCCTGG
GCTTGAGCTCCCCGTGGTCCTCAGCGTTGCACGCGGCCCGAATCTAGCCGACTTGCATGC
AGGTAAGGCCGGGCGCGGCCCGCATTCCCTGATGCAGCCCGAGCCTGTGATGAATTGCTT
GAATTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTCGCAAGACTGAG
GCTTCGTGCGCTCTCCTGGGAGGGCGGGGTGAAGGGGCTTTTTGCGGGACATGGGTGAAT
GTTCCCAGCTACAGTGAAATGCCGTCTGACTTACAGGGCCGCCAGTGACCAGGCTGGAGA
CTTTGGACCGAAATCGACATCCGTGCCCGGGCCTTGCTGGTGAGACAGTAGTTGGAAGAT
GAAGATGAATAAGAATTTCCAAGACATATTTTTTGGCCCACACCTGGTCCTGCTCCTGGC
TCTGCATTCAAGAATTACTCCTGGCGGTGCTTGGGGGGATACTGGGGATTGAACCCAGGT
CGGCCACGTGCAAGGCAAACACCTTCCCCACTGTATGATAGCTCAAGCCCCAACCTATTT
TATGCTCTGACCTCAAGAAGGGAAGGTGGGCAGCCGGCCTCCAAGGCTGGGGCACATGCT
TTTCTAGCTAGAGGCCTGGCTTTGGTACCTGGCACCACTATGTCCAAGTGCAAAGCCAAT
AGTGCCCTCTGAGTTGAGCAGTGGCCGCCCGCTTGCCACTGTTCCCAAAACAGATGCCAT
CACTGGATAGCAATTTGGGAAGGTGGGAGCTGGGTGGGATAGCAAACCCTTTGGGACACA
TCCAGCAGAACTGGCTGGTGTCGGGCCATGGGAAAGTAAGTGCCCTTTGTAGTCTGGAAA
TAGGCCCGTTGGTTACGTCATCTTGCAGCTAAGTATGATCATTAAGAGAGGAAAAGTGGT
GCTGGAGTGATCTTAGAGCGCCTACGGCACTTGCCTTCCACACCGCTGACACGGGTTCCA
CTCTCCCACACACACCAGCACCCTGTATGGTACCCCGAGCCAGGCAGGAGAGGTCCCTAG
GCACGGCAAGCTGTGGCCCAAAAGAAGTGTGCTTTGAGATGCCTGGTGTCAGAATTGGCC
CAGGAAGTACAGTGGCTACAGTGCCTGTTTGTGGCTGTGACAGTCTTTGCAGGGGCTCTG
GCTTTTCTGGCCCTGCGGATCAGGTGTTAGGGAGGCCTCAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved