Sorex_araneus Locus Mono:391:SNORA29
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:391:SNORA29
Sorex_araneus
Mono:391:SNORA29
scaffold_254182
SNORA29
1001..1140
2140
CCCCTCCAAGAGCCAACATTAACTTCTTGTCATGTGATGAGGCATCTTAAATATCAAGT
TCAGTGGAGACTAGACAATCACACCTTAGGTGACATCTAACTACAATCACATGAAAGATT
CTAGGCCAGCACTTCCCAGATAGGCCAAATAAACTCCCTAACTATGAAAAATAATAGTAA
ATCCTGTTCTTGGTCACAAGTTATGTGAGATTCAACAAGAACAGATGTTTATAACTGAAT
TCGATGTTGCTTCTAATACAATATAACTTCCCCGTGAGTAAATGCTCAGAAATGTCTACC
AGCTGCATGTGCACATGAAAACATCTTGGACATAAGGATGATAACCAAAATGTGAAAATT
GTGAAAGGGGCCACATGGCTTGTATGGGCTAAAGAGGAAAACTAAAACATATACACTGTT
TTAATCACTGTGAGATAAGTGATCACCAAAGAATTGTGTTCACCAGAGAAATAGTCAAAA
GATATTCACAGGGGAATTTTATGAAAGTCATTTAGATTTCTTATTGTGTATCAATAGGAA
CTTAATCATTTCTCAAATGACAGAAAATATCAGTTGACATGGATATCAATTTATTCAGGT
AAGGAATATTAATTGCTAAATTTGACCTATCTTCAGTGACTTCTTATTTATCTACATGTC
TTCAGTGCATCAGAAATATTTGATTGTTTACCAAAATGCCAAGGAGTATAAAGAATTCTC
CTTTTTTAAGTCTCAAAATTGATAACAGAAATTGTGATATTCTTTTTTGCATCCTTTTCT
TCATTTCACAAAACATCACCACTTCAAGAATGAGACCAGGCAAGATAATAAAAATCAGTA
TGAGTGATAAATGATTTGTTAACAATCAGAAATATTACAAATTATAAGAATTATGTTTAG
TTAACATATATGTTCTAGAGTTAAGAATATATGCATCTATAGTTTTCTCTTTAGAAAGAT
AGTACAGTCATACTAACTTTGTATTAAGAATTGGTGAAACTTTTCCCATTTGACTGCCAC
ATTTTCTCCTAGTGATAGTTTTTAGTGGCTATGCTTGTGGGATAGAGTGAAGCTGCCGAG
ATCTGAAGGGGGAAGATTTCTCCGTGTCTTCCTTCTATATGAAACGGCCGGACAGAAAAC
GGGTACCTGTGGCGGGTGAACTTGATGGAAGGGACATTGTGTGGGAGGCTTGGCAGCTGT
CTCAAGTGTACTCTTCCCCACACAGGAAACAGTAAAATAAATATTTTTAAAAAATTTAAA
AAAAAGAATTGGTAAAACTATTCTGTCATTTGAAGTTTCCAGAATTAGAAACATAGCCAA
TAACTTATATATTAATGTTTCTGTGTATATGTATGTATGCATACATATACACAGATGCTG
TTTTGTCAAAACACATTTGAGACCATTGCCAACATTGACCAATTTGTTCAAAAGACATTT
GAGACCATTGCCAACATCATTTGAACTATGTTAAAACAGAGAACCAAGAAAAGCCAAAGG
GAACAAACTACACATGAGGTAGTAAATAGAACTTGGACTTGAACATCAAATTTCTTTCAG
AATTCCCTAACTTAACAGTCAAGAGAACATAATAGAGATCTCATTATCAAAAAAATTCAA
TAATATATCTCAAATCAATCCCAAACAGCTAAGGAAATGGTCTGTAATGTGTTTGGTTAA
AATCCATATATTATAGTGCTGTAAGAAGGTGAATTGATATTAAAATAAAAAGAGTCACAG
TGACTAGTTCATTAGACTCAGCATAAAGACAATTTGGTCTAGGCTGAAAATAAACAGATA
CAAAGAATGTTCTTCATATGGCAAATCTCAATTAGTTAGGCATTTGCATAGATATTTATA
TTAGAAAAGTTAGTGCACCAAGATGGATGATTCTACACTAAATTCTATTCTGTTACTAAA
TTTTGTTAAGGATATTAATACTATCTGGATACATTTGAAAATTATATGTAAATAAAGCCA
TCAGTTGCTATATCGGATAAAATGAACAGTATTAACAAGAATAAAAGGATTTTGGTAAAC
TGAACCTAGGGCTATCTCTGTTTGAAAGGCTTAATGATCATCAAGTAAGTTCCCTCTGTT
CGAGGGCAAGAGTCTGAGGAAGCATAAGGATTGAGATTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved