Sorex_araneus Locus Mono:762:SNORA36
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:762:SNORA36
Sorex_araneus
Mono:762:SNORA36
GeneScaffold_2049
SNORA36
1001..1132
1332
TTTGTGTGTGTGTGTGTTTTCTTTTTTGGTCACACCTTAGCGTTGCTCAGGGGTTACTC
CTGGCTCTGCACTCAGAAATTACTTCTGGCGGTGCTCGGAGGATCATATGGGATGCTGGG
AATCGAACTCGGGTTGGCCACTTGCAAGGCAAATGCCCTACCGGCTATGCTATCACTCCA
GCCCCTAAAATGGGTTTTCTTTACCTAAGTATTGAGGTTAGTTCAGGGCTGCTTCCCTGT
TCTGATAATTTAACTTTGGGACATTAAGACAAGCTGGAGGAGATGATTGTGTAGAAGGTA
TTCCTCTATTTATATACCTCCTAGCCTACAAAAAAAATGTTTTTGCATATTGATTTTTAT
TGCCTACCACTTTGCTGGGTGATTTCAATGGAGTTTGGGGTATTTTACAGATATATTATC
ATGTAACCCACAAACTATAGTTTTGATATCTTTCCAATTTGGACTTCTTTTTCTTGCCTA
ATTCCTTTGCTTAGACTTCCAGTTTTCTTGAATTCAGACCATAGCACTAGAGTTCTGTGG
AGGATGTAGGGGACACACAGGAGTGGAGGGGATCTAATAGACCGTGATGGAGAGTTACAG
CATTTTAATAATGGGCATGGTGTGACAACTCACTTTTTTTTCTTTTTTGGGGTCATACCC
GGTGATGCACAGGGGTTAGTCCTGGCTCTGCACTCAGGAATTACCCCTGCCGGTGCTCGA
GGAACCATATAAGATGCTGGTAATCAAACCCGTGCAAGACAAACGCCCTACCCGCTGTGC
TACTGCTCCAGCCCCTGACAACTCACTTTTTTTTTTTTGGCTTTTTGGGTCACACCGGCG
ATGCACAGGGGTTTCTCCTGGCTCTGCTCTCAGGAATCACCCCTGGTGGCGCTCAGGGGA
CCATATGGGATGCTGGGAACCCAGGTTAGCGGCATAAAAGGCAAAAGCCCTACACGCTGT
GCTATTGCTCCAGCCCTTAAAGTCCTCGTTCTTCTTTTTTTTGGGGGGGGTCACACCCTG
CGTTGCACAGGGGTTACTCCTGGCTCTTGCACTTGGGAATCACTCCTAGCAGTGCTCGGG
GGACCATATGGGATGCTGGGAATGGAACCCGGGTCAGTTGCATGAAAGGCAAACGCCCTA
CCCACTCTGCTATCGCTCCATCCCCCCTGACAACTCACTTTTAAAGAGACCTGAAAAAGC
ACTCCTGAAATGTGCATACAATGATATAAACCAATGTTAACTCCGCATAAATAAGCACAT
AAATAGATGATAAATATATAAATTAAGTTTTCAGTTATTGGCGTTGAGTGTCTGATGAAA
ATTAATTGGAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved