Sorex_araneus Locus Poly:4:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:4:SNORD116
Sorex_araneus
Poly:4:SNORD116
scaffold_190090
SNORD116, SNORD116
1001..1095, 2626..2722
3722
TGATTTTGGTTGTGTTCTATGAGGTGTATGAGATGTGGGAACCTTGCCTCTATGCAGTC
AGGGTAGTTGAATCACTCACACAGGATTCATATAGCCCTAAAATGTTTGATTCATACCCA
AAGGAGAGAATCCCAGCCCAGTATCTAGATTGTCAACATAGGGTTGTTCCCTAGTCAGAT
TTCATTTTGGGAAACTGTCATGTGTTGGGAATTTGGAGGTGTTTCTATCTGAGATACTGT
TCTAGCTCTGGGATACGGTGGGTATATATTGACATTTGCCAATGTCATCCCTACCAACTC
AATCTCTAGTGTCTCACCAAGGGCATTGCTTTGAGGTTTGGAATATGGCAAGAATTCCCT
CATTTTTGTTTCCATCATTGTCCACTTGGCTTAATGTAATAGTTTCAGAAGCGTCTGCCT
ATCCAGCTACTCATGTCACCCCTAAACCACTTCAATAGTTACCATTAGCCTTACCTTCCT
TTACTGTGCAGCCTAAGTTCAGCACAGATTTGATTAGTAATAGCTGAAATAAAATTGCTG
GGATTTTTGGGGACTGGTGGGTATATATGCATGTACAGAACTGATTCGAGATCTCAAAAT
GTTTCTGATGTGTTTGCACTTCTCAGTTGGTGTAGGCCTGCAGGGTCTGTTGTTTGGAGT
TAAAAGAGGAGTCTTACCTGTTATCGGATGTCCAGAGATGCCTAGCTGTATTGGATGAAG
TGTGAGTTAGGACGCACCTCTGCGACTCTGGAAGATTCCTGGTGGTGAGCATTCTTTCTT
CATTTTTCTGTTTTCCAATTGAGCTTCTCAGAACTCCCTGAGTAGTGGTGAAGGTATCCA
AGATGTCTGTTTTCTCTCTCAGAGTACAAGGCTTTTACCCCAGATCATGGGAGTTTCTTT
AAATCCTCAAATGCCTTGTAGGCCATGAGTTCATTAACTCACCTGGTAAGCCCCCTACTG
TGCATAATACAGGTGAAGATGGTAGCCTCCCCAAGTTTGCTGGATCGATGATGATTTCCT
CTCAAAAGCATTCCTTGGAAAGCTGAACAAAATGAGTGAGAACTCAATACCACCGTTCTC
CTCGACGCTGAGGTCCAGCAAGCTCTTTGACAAGGGATGATGATAGCCATGAGTTACATA
ATTTCTCAGGAATTATTCTCCAGTATCTCCTGGGTTTTCTTCCCCTTTTGGAGTGCTTCT
CATTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGCTGATCCACC
CACTCTTTGTAGGTACAGGTGACATTGTAATCTCCCTGATTTTGCTGGATCGATGATGAT
TCCCTCTCTCAAAATCATTCTTTGGAAAGCTGAACAAAATGAGTGACTACTCAATATTGC
CGTTCTCCTCGACTCTGAGGTCCAGCAAATTTTTTTGACACGGGATGGTAGCCATGAGTC
ACATTGTTTCCCTTGGCAGTGTGATGCTATATTTTCTTGTGATTCTTTTCCTTAGGAATT
CCTTTCATGTGGCCACTGGGCTTGGCTCAGGGAGTTCTGCCGTTTGATTGTATCTAGTAG
AGATATCAGAATATAAAGATGCTATGCTTGAGAAATCTTATTACTGTCCAATTTTTCCTT
AGTGAGGTACTGAATGTTCTGAGGCAGTTGAACCTGGGGAATAAGCTTAGACTCATGGAG
TAAAGGATATGGCTATCTCTTGCTCAGTTTCAGATGCCTGTGTGATTTCTTGCATTGTGG
CCACAGATAGGGTCTTCCCCTGTCGTGTAAATTTCCTAAGCCATGAGGACCAAAAGTTAT
AGAAGAATCCAAACTCCTTGTGTAAATGTGGTGAGAGTTGAAATATATTTTATGAGTTGA
TTTTTGAAAGTTAAGATCAACTCTTGGCCTTGGTGTTTACATGCTGGTGTTTTGGCTTTG
ATATTTTTGTTTACTCACTTTACTTTCATGAAACATATGCCATGTTTTATTTTTACAGGG
TTATCCATATATTTGTGTCTGAATATTTGGGCTTCTTTATGATTGTTGTGTTTGTATGTG
TGATTGCTGCGACCACTGGTGATTTTCGATTATCTATTCCAATGGGGTCATTTACTAATG
ATCCCACTCAAGATTATTTCTGTTGGATGAAATGATTTCTGGGGACAATACCTGCACAAA
ATCTTTGGTGGGTTCATGTACAGAGGACTTATACTACTTGTTGAAGTTTATATTCATCTC
CCCAGTTGGGAAAAGTGACCCACAACCTGACAACAATATGAGTGTTTCATATACAGGTCA
CCTTGTGGGAGACCATACTTTTTTGATGTCTGGAGGTATATATGTGAGCCCTCACATCTT
TTCATCAAAGCTTTCTGGATATAATGTTTTGAGATTTCCTGAGTGGCAGTTTACCTAAGT
TAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved