Sorex_araneus Locus Mono:809:SNORD111
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:809:SNORD111
Sorex_araneus
Mono:809:SNORD111
GeneScaffold_5596
SNORD111
1001..1079
2079
CCAAAGAAGATGGCAACATTCAGTCTCATTCTCAAGCCACTATTTTCCTGTATATAATA
TTGAAAAAAAAATTTAAGTGACAGACACCTAGCTTCTTAATGGAAAAAAAGTATATATAA
TATAATATATATAAATAAAAGATTGGATTAGGCAAAATCTTTTTGAGAACCACTCCTGTC
TTGTTTTGGTGGCTCCTTGCTCACACCCAGACACTGAGTTTGTATTCCCTTTGCTCTCTG
CTGGGGGAACTCCAGCTCAACAGCTGAAAACGGTCTGCTATTTTAGGACACTGATTGAGG
AACTGTCTGCCTCCCATGGGGATCAAAAAATAGTTGACCTTCCCCTGACTATAGAGAGGA
GTATCATGATCTGGTTAGAATGATAATTATTGCTATTGGATAATCCATAGAAGTGGAAAG
AGGATGGAGTGGCATGAAATCATTGACACTGTCACATTCAGATGAGTGCTCACAAAATCA
GGATGGGACTGGACAGATAGTTCCAATGACATATCATATTTCTATCAAGCCTAAACCCTG
AGTTCAATACTGAGGACCACAAATTCACTCTGAACCCCACAAGGCCAGCACCAAACCTTA
AAACCCAAATGCCTGAGCCATTGTCAAAAGTGGTCTCTATTCACAAAGAAAATTTACTGT
CTCATAAACTACCTAAAAGATAAAAAAAAATTACACATTAAATATATTTTATTTTATTTT
TTTAATTTTATTTTATTGAATCACCATGAGATATAGTTACAGGCTTTCATGTTTGAGTTA
CAATCATATCAAATATATTTTAGAAATAGTACTTTCCTAATAAGCTCTCAGACTTTGTAA
ACATTTTTCCAAATAACCATTCTAAAGTAGGCTGATTAAAAACTGGAATAAAAAATGTAT
TGTTTTCTGGATTACAATAAAAGAATCTCTTACATTTTATCTTTCTTTCTTCTTCATTTT
AAATATCCACCTTTTATTTGAAACCCGTTCCATCCACCACTTAGCAAAAAGATGTTTATT
TTATTCATGTCTCTTCTCTTTACTGCTTGTATATTTTTCTTTTCATGTCTGAACATGCCA
GAAAGTATTTTTAAGGATTTGTAATATTTCAATAACAGCAATATTTTAAGACTTGCATTG
TCACTACAATTGCTTTTATGTTCTGTAAAGTAGCATTTGTCACCATACGTTTTAAAGAGT
CATCTAAAATCTACCTATTTCCTTCGCTGTTTATTTTTGTTTAACATCAGTTAGAACTCT
AGGTCAGAATTCGGTTAAAGCACAATGATGAATCCTTACTGAAGATGTTAGTGTTTGGCA
AGCACCAGCTCTACACAGCAGGAGATGAGCAGAGAAATTTTAAGTCTGGATCATTAGCTA
TACAGTTAAATGGAACATAAGAGTATATCCCAAGCTTACCACTGGATATGAGTTCAATTC
AACTTTTTAAGATTCTTTGTGTCATCAAATTATATTTGTATTTGAAGATACCCTGTCTAC
CTCACTCTGTCTGAATTTCTGCCAAAATTTGTGCAAAAGATGCTTTGCTCTGCTTAAATA
TTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved