Sorex_araneus Locus Mono:151:SNORA26
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:151:SNORA26
Sorex_araneus
Mono:151:SNORA26
scaffold_154493
SNORA26
1001..1123
2123
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATACAAAAGGCCTTGCATTGCA
AGGACCTTGACGTTATTACAGACGCTCCCCTCACTTCAGTGTTATCCCCTTGTTCTTGGA
TTTGGCTCAGGTGGGCTCAGTAAATGTCAATGTAAGACTGGTTGTGCCACTTATGAGATA
TTGAAAATACACTGGGGAGCCTCCAAGGCTCCGTCCAGTGGGCAGGATACTCTTAATAGC
TTGCTGGGCTCTCCGAGAGGGGCAGAGGAATAGACCCCGTGGCAAACACAGGCACGGTAA
ACGCCTTAGAAGCTGTGCTATCACTCCAGCCCAAAAACAGCATATGGACTTTTATATAAT
ATGCACAATGGTATCTTAAAATTAGAAAAATTGACCTTTCCTCTCTCTACTAAGGTTGAC
TTGGTGCTTTAAGAGGTTCACACAGAAGGAAGAGTAAAGTCCCCACACAACCAAGAAAGA
GCATTGTAAATCCTCTCACTAGGGTTCTTTCAGGAGTCATGGCCAAAGGGATAAAAAAAA
AGAATAGAAATTAGAAAAATCTCTAAGGTATACAATGATATAGGAACAAAATAAAATCCA
ACAATAAATTTAAATTAAGATATAAATAGACCATTATTTAACATCAGGCTGGGGAATGCA
TTAAAAACGAAACCACCTTTGAATGCTTTTGATGATATAGTCAGGTAATGCTGCTAAAAA
ACTAACCGACATATATATTAGTATTAATTCATTATTGCACCGAAATTAGTGAAGGGAAGA
ATCTTAACTGCAAATATATTCAATCCCTTACACTCTTTTAAAAGTTTAAAAGTTTAAACC
TTTTAGTTTAAAAGTTTAAAAGTTTAGTTTAAAAGTTTAGTTTAAGGGGCTGGAGCGATA
GCATAGTGGGGAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATTCCCAGCTTCC
CATATGGTCCCCTGAGCACCGCCAGAAGTAATTCCTGAGTGCAGAGCCAGGAGGAACCCC
TGTGCATCGCCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAAAAAAAGTTTAGTT
TAAAAGTTTAAGTATGTTAAGGAGAGCATAACTAGTTAGAATGTGTGTCAAAAAATAATC
AAGTTACTTACAAGTGGATGAAACATAAAGATGAGTAGAGAATATTATTTAACACCAAAA
AGTTGATGCATACATAGGATACTACAAAACTTCATCTCCCATTTATTGTTTACAGGAATT
ATTTGGACTATGTGACTAAATTAGCAAATAGCTTACAATTTTCTACGTTTATATTTTTAC
ATCAGTTCATTAAATATTTAATGTTTTAGATCTTAAGATTTTCTTAAGTAATTAATGAAG
ATTTAAATATAGTTTATTTTGTTTTAATGACAGTATCTAAAACAATCTCTTCATGCTTTC
TTTTTGAGACTGTCCTCTATTTTCATAATCATCTGGATTTTGCACACACTAGGTCACATA
CTTTTGTTTATATAATATCCTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved