Sorex_araneus Locus Mono:100:SNORA63
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:100:SNORA63
Sorex_araneus
Mono:100:SNORA63
scaffold_240845
SNORA63
1001..1140
2140
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTTTTGCGA
GGGGGCAAGTGAATGTGGAGAGAGGCGTATGTTCAGTATCTGTCACCACTTAAGTTTCCC
CACCTCCAGCACTAATAGGTGTGTCCCCCCATTTCCCTCTCCCCACCCCCCCCCCAAAAA
AAGGACCAGGTAACAAAGCCAAATAGGGTAAAAGAAAAGGATGAACTGAATCTGTCTTTA
GATTTCTAACCTTAACAACTAGATTGGAATAGGGGTCATTTATTATCATGAGAAAGGTTG
GGGGAATACCTTGATAGATGGGTCCTTTTCATCATGGAATCTCACTATTCTTTCCTAGGT
CAGGGGAAGGTAATAAACCACAGCAAACCAGGCCAGAGCAAAGTACAGTGGGTAGAGCGT
TTGCCTTGCATGTAGCCAACCCAGGTTCGATTCCCACCATCCCCAAGCACGGCCAGGAGT
GATTCCTGAGTGCAAAACCAGGAGTAAACCCCTGTACATCGCCGGATGTGACCCAAAATG
CAAAAAGAAAAAAAAAACGACAACAACAACAACAAAAAAAACACAGCAAACCTTAAAAGG
CCTTATCCACAAGGGATACAATGTTAAAACAATCTATAGAGGTAAAGAGAAACTAGAAAA
CTTTCTCTGTAAAATCTCATTTCCTTATTTTGTTTTTAATATGTCCATAATCAAGGACTC
CAAAAAACTATGTTATAGCAAGTTTTAAAATATCAATTTCCAAACAGGATTTAGACTACA
ATATAAGCTCTAAGTTTTGTGTTATCATTCCCCCCTGCTTAAAATAAAGTTATTTCTTAA
TTAACTACACCTGTCTGATTGACACCTGTTGCAGTCAGGAACACTTAGTAGTCTCATACA
TTTTTTTTTAATCAATTTCCCTGAATTTTATTTATAAGACAGGAATTTGAGACTTCCCTA
CAATAAAGACAGTCGCAAGGGATTTTTGTGTATTGGGCCACACCGGTGGTGCACAGGCCT
TCCTCCTGGCTCTGTCAGGAATCACTCCTGGCAAGGCTCAAGAGACCATATGGTGCGCCT
GGGATCGAACCTAGGTCAGCTGCATGCAAGGCAAGCACCATACCCCAATGCTGCTATATA
ATCACTCTGGCCCTTATATTAATAAATATTAAATCCTCAATAATGAAGGTTGTTAAAGGA
AGGCTACCACCTCTGAATTCATCATTAATCGCATGTGTCTCTCTATAATAATGAACACCA
AAAAAATATTTTTATCAGATTTTTGCGTAATTATTAACAGGAGCTCTTGCCTGTTAAATT
AGAGCAACAGGAGAACTTCTAATTAGCATGTAGAAAGAGATGGAGTGCTCAATTTAAACA
CATGAATCATGGACCAGGGAAATAGTTAACAAACTATAGTGCCTACTTTATATGCAGGAA
CCCCAAGTTCCATCCCCGGAAACGCTGACAGAATGACCCCCCCAAACACCATACCAGAAG
TAACCATCAGCATCACCAGGTATACCTAAAACATATAAAAACAAAAGCCCCACAAACATC
ATGAAGCCCAGAAGATCCAGCAGAAACAAACTGAAGGGAGAAGCCATGCTTCCTGAATAT
ATTATAAAAAGAATTTACTATCCCAGTTTTAAGTTTTTTCAGAATCACAAACTACTACCT
ATTAATTTATAAATGAAATCCTTTCACTCTTTGTAGCTGTTTAACATAAAACTTTCAGTA
TTAACTTGTAGTGTATTCAAAATAGGAGATTTTTCTTAGTCCTAGCAGAAATAAACACTT
TCCTAACTTGTTCTGTGAGCTATCAGATAATCCAGGAACAAAACTCTTCCCTTCCTCTTG
AGAAAATATCTGGCTCTGGGTTGGGTTGATTATTTTGCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved