Sorex_araneus Locus Mono:533:SNORA24
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:533:SNORA24
Sorex_araneus
Mono:533:SNORA24
scaffold_257071
SNORA24
1001..1115
2115
CCTTACATGTACTTTCTCCTCCCACTGCTTGGTAATTTTATTTTTGTAATCAAATACCA
AAGGCTTGTCATCATTTGATATTCCCTTTTCCTTTATTTTTCTTCTCATTGTTCCACAGA
TGAATAAGATCACCTGGCATTTGTCCTTTTTCCTCTGACTTATTTCAAAATCGTATTTTA
AATATATTATACATAGTGATCTATTTTTTAACCTTCATCCCAGAGCAGTTTCACAGATAT
TATTTCAGTGTCAAGAACACAGCATTTTTTTTTACTTCAAAACAACTGTGAAAAGGGAAG
GGGGTAGGAATAAAAAAGGCACAGGAAACTGATTATACATGTATTAATAATTGATAAAGA
TAGATGATGGTTTTATAATTCTAATCTCTGTCCACTGATAGGTATATCTCTGTACATTGA
TAATTGTTGTACAATGTATAACAAAAGTTTTTTTCAAAGACAAATTGCTAATAGGGAAAT
ATAAATACGAGTGGGTTTTAACTTTCATAAAATACAGAGATTCACAAGGACCTCTGTTCT
CGATTTATTCTCTCTGAAATTTTGCATGTGCTCCTTCTTTCACCTAGATTACTTGCCTCA
TTTCCCTTCCCTAAGTTATTCGCCAACTTTTATTTGTATACCAGAAATCACTTTCTTTGA
AGGTAGTTTTCCCTAGACTAACTTATGCTCTCCTGTATGTGTTCCCGTAGCACTATTTCC
TCCCCTTTTCAACACGTACTACACATTTTATTTTCATGCTATGGCTAGATTATATGAGCT
ATGAAGCAGGGACTAAATATGTCTAGTCCAGAGGGTTTAGTATAATGCTCCAGACATAAA
AAGAATTCGGTATTTGTTGACTAGAAAAGTGAATAATTGAATGAAACAGGTAAAAGCCTT
GTTTCTGGTTAAACATCAGCATAAAATTCTGGAATCACCCAAATGCCCAAGAATAGATGA
CTGGATAAAGAAGCTACGGTACAAATACACATGAAATACTACTCAGATATAAGAAAGGAT
GAAGTCCTTCCTAGCCATGGAAGAGCAAACTTTGTTGATTGGCAAAGCTGGCACCACGTC
GTTGGTATCAGGTTCTGACTTGCACGAGGGACAGTCACAAAGACGGCATGCGGCGGGGGG
CAGTCCGGTGGGGTGCGTATGTCTGCAGATCAGACTTGTGAAGGTAGGGTAAAAAAAAAA
AGAAAGAAAGAATGAAGTCATGCAATTTGCTGATGTGTGGATGGATCTAGCTAATATTAT
GCTGAGTGAAAGAAGTCAGAGGGAGAGGGACATAACAATGATCTCACTCGTTTGCTGGAT
ATAAAGAAACACAGTAGGGGAATAACTATACCCAAAGACAATTGGTAAAAAGAACAGGAG
AACTGATCCTCAGTAGGAAGCTTGCTACTGGGGGTCAGCAATGGGAAGAGGTGGGCTAGG
TCAGGGAAGGGACAATGATAGAAGTAAGGGGTTACTATGGACCAGGAGGTAAACTGACTT
GATATAACTGCATCGGTAACAGTATTGTTAACCACAATACCTAAAGGGGGGAAAAGAAAG
GAAAAAGCAAAAAGAAAATAGTGTGTGCCATAGAGTCAAGCTAGGTGGGCAGGAGGGAAA
CTGGGGACATTGGTGAAGGGAAGTGAAGGGATTGGTGTTGGAACATTGTACACCTGAAAC
TCAATCATGAATAACTTTGTAACCCTGTAATTCATGTGACTCAATAAAAAAAATTAAAAA
CAGGAGGCACGATAAATATGTGTTGGGAGAAGGAAGGAATGTAGAAATGAAGCTTTGATG
CAGGCTTTACAGGAAGAAATTGTAATGCAGATGTACGTGAAATGGGATGCATTGATCGAA
AGCTCAAGCGAAATAACTCTTATCTTACAATAAAGTCGGAGGTTAAAATAGAGAATAATG
GCAAACAACTAAAATCACATATGAACCAGTCTCAATTATTTTTAGACCTATTATATTTTC
CTTCGATCTATCACTACTGAATGCTAACTTTATTTATCTCTACCTATCAGTTTACCAAGC
TACTGAGAGTATCCTGCCCGCACAGCAAAGCCTGGCAAGCTACCCGTGGCATATTCGATA
TGCCAAAAACAGTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved