Sorex_araneus Locus Mono:403:SNORA2
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:403:SNORA2
Sorex_araneus
Mono:403:SNORA2
scaffold_204864
SNORA2
1001..1134
1338
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCCGCTGGGAGATGCCGAGGCAGCAGCGACTCTCCG
AGAGCCGTGCAGAGAGGCGGCGGCCCTGCCCCGAGCCTCAGCCCGCGCCCTGCGTCTGGA
GCTGCTCTGAGGCTGTTTCACGGCAGGCGGGTGCTGGTGTCGGGTCCCACCTGAGTGTCC
CGCCCTCCCCTGCCCAGGACCCCTCCGTCCCCACCCGCAGTTTGCCGGCTCTTTACAACC
CAAGGCAGGGACTTGAGACCGACTATAATATATTTTTTGTAAAACCCTTTTTTGTCCTGC
AGTTTCCTTCTCTAAAATCTTCTAAATTTAAAGTTTAAACACGCGAGCACAGAGCCCTGG
TGGGGTGCAGAAGGCACCTGGGAAGGTTGCGTCTGGGCCAGACCGAACTGCCCACAGACC
ACACCAGGACCCGGCTGTTGAGCGCGTTACTTGAGGAGGAGATCTCTAACGTCGTGCCTC
ACTCTTCCTTTCTGCTAAACTTCAAATACTCAGTTCGGAGCTAACTGAAGAACGAGGACA
TCGGTCAGCCACAACTCCAATAAGACCAAGGACACGCGGGTCCTTCCCCAGCCTGCCGCC
CCGCCAGAGCTCAGAGACTTCGTCCCCTGTGGTGTTTCCGCTGGGCCTCCTGGCGCGGTC
AGACGCAGACGCCTTAGTGCAAGGCCGCGCTCTCTGAAAGCACGACCCGCTGGACCCAGG
CTGCGGTTGCTGGAACTGCTGGTTTCAAGCAGGAGCCTAGAGAAAATCCTCCTGCGATCT
GTGGACCGTCTCAGTCTCCTGAGTGTGACGGTCACGGCTCCAGGAAGACACTCCTGAGAG
CGGGAAACGACCAACTGGGCTCCAGGGGGAGGGAACTGGATACTCGCCGTCAGGTCAGGG
GCCGAGGTCTTGGCGCGTTTAAACAACTGATGGTTCATTAAAGTAAATGAGATTCTCTAT
GGAAGAAGAAACGCGACTCATGCAGACGAATATAATGCTGGATTCTCGGACACGGCGTCA
AAATACTGTGAATGGGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved