Sorex_araneus Locus Mono:568:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:568:SNORD116
Sorex_araneus
Mono:568:SNORD116
scaffold_234385
SNORD116
1001..1101
2101
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAAGTCGTTGATTGCTACCACACACACATCACACATCGTTTATCCACACAAGAC
TATGCACTTTTTTCCACAGTCCTGCCTTCTTGTGTGCTGTCCCCTATGTCTTCCATCCTA
CTGCATAGCCATTTCTCTGTGATGGCAAATGCTATGTTGTAGTTACTCTACCCAGAGCAC
ACCACAGAAAGTGATTATAATTTCTTAGACATAAGAAAGCCCCCTTCACATATGTAACCA
GACATGGATATTCAGTCCTTCCCTAAGGACATCATAATACAATGCTGTCCCTCATGCCTG
TCATCTAACCTATAGCTACTGATTTTTGAGTGCAAATGCCAGGTTGATCCAGGGATATCT
TGTGCCTTTGAAATCTTACGGCTACTCCATGGCCATCTTCTAATGCATTTTACTTTTTGT
CTGTACTTCTCAGGTGAAGTTTGTCGGCCATATTCTTTGTGCACCTTGACAATTGGCCAG
TTTTTTCTAGAGCAAAGGGCCGCAGTTTCCTCAGGTCGTCTGGCCAAGTGTTCTTTCCTC
ACAGCCACTTCAGAAGGGTAAGTTGTGACCTCCTGTCCTATATTTCATCTATTTTACTCT
TATTTCTGCCAGTGTTGAAGGGTTTTTTGAGGCTCTCTCCCCTTAGGCATATGTTTTGGC
CCAGGGAACTATTTGTGTGACGAAGCCTCCCCACCGTGCTTGGATCGATGATGAGTACTC
CTACCTCTATGCATTCCTTGGAAAACCTGAACAAAATGAGTGATAACTCATACCACCGCC
ATTATCGTCGTATCTGAGGTCCAGCACTTGATGTTCATCCCAGATGGTAGCCATAAGAGA
CTTATTTTACTTGATCAAAGTCCTGTAGCACTCTCTGGGTCCCTTTTAAGAGGCACTTAG
AGTTCAAGGGGCTGGGAATTTGTTTTCTGTGGATGATTCAAGTATCATAACCACACAGGG
GCATGAAGTCCTTGCTAGAATCATGCCTGGTCGTTCCTGCCATACAAAGTTTTGCTATTG
GTTAGTGAGGTCAGATGTCACACGTTCTCAGGGTGGACCTATGGATTTGATCTCTTCTGC
CTGGACCGTGGGCACTCTTGTTTTCTGCTTTTTATGTTTACTGCTCAGGTGGAATTTGCC
TACCACACTTTTGTTCTGCCAGAAAGAACTTCCTGTTGTCTTCTGTGTGGTGACTGATGA
GATACCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved