Sorex_araneus Locus Mono:710:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:710:SNORA58
Sorex_araneus
Mono:710:SNORA58
GeneScaffold_7038
SNORA58
1001..1115
2115
ACTTTGACTCTGGTCCCCAAAGCATAACTGGGTGTTGCCCAAAGTGGGCCCCCTAGGGC
TGAGCAACTACCAGGAGTGGCCCCTATAAAAAGAGAAATTACCTCCAGAAATTTAGGGTG
GGGGGCATGGTGCCACGAGCAGGTCAACCTGTACCTGCAGGGCAAGTGCATCAGCAGTGT
GATGGTGTCTTTAGGCTTCCTGATACCCTAAAACTGCCACTGTGCCTCTGGCCGGGCCCC
AACAACTTAGAACCAAGTTTCCCAAGAAATTAAATGACTAAAAGTTAGGAATGTGTGAGT
TATGCCCACAAACCACCTCCAGCTCAGCTATACAAGCTCATTTATCAGCCTTGCTTCAGC
CCATAAATCTCTAAAGAGATCAAAAGCCACAGTTAATCTCAGACCTGCACAGGGCTGAGC
AGACCAGGGTATATTGGAGAGGGGTAGGTTAGCCTGGTGACTGCCCAAGCAGAGCCTCCA
GCAGCCACTTGCTCCCACAGTCCAAAATCATTACAATGTCCCCAGGCATACTTCACTGTC
TCTGGACAGATCAGATCTCACTGAGATACTAACCTGTTGAAAATTTGAATATGCAGGTTT
TATGACTGAAATCTCAGGTTTTCTCAAAATCAGGATGGGCTACCTCCCCCTACCTCCCTG
TACTTCTGGAAGCCTCGGCAGTCACATCCACACCCCAAAGTTGCCACCCAGTAATGCCTT
ACCATCCAATAAAAATACTGAATGCCCTGAACAAACGCCATGACCTCTTAGTACCTGTAT
TGCAAACCATATGCACAAAAGGAAAAAAACAGAGAGAAAGAATAAAAGTGCCTGCCATAG
AGGGAGGCTGGGGGTTGGGGGTGAGGTGTTGGAGGGTGATGGGAAATGGGGGGAAATAGG
GGACACTGGTAGTGGGAAATGTACACTGATGGAGGGATAGGTGATGGATCATTGCATGAC
TGAAACCTAATCATGAACAGCTTTGTAATGGTCTACCTCATGAATATTCAATTAAAAATT
AAAATAAAATAAAATAAAATAAAAAGGAATGTGGAGTTCATGCCAGCTTCAATCAGCTTA
ATCATTGGCTGAATAAATAGCAGTACTCCTACAATTAAAAAAATAATAATAATAAACTTG
TGGGGGTATGGTGCCGCCAGCAGGCCAACCTGTACTTGCGGGGCGGGTGCATCAGCAGCC
TGATGGTGCCTCAAGCTTCCTGATACCCCGAAATTGCCACTGTGCCTTTGGCCGGACCCC
AATAACTTGGGGCCAAATTTACCAAGAAATCAAACGGCCAAAAGTTAGGTATGTGGGAGC
CACATCCACAAACCACCTCGCGCTCAGCTATACAAGTAATTTAGTGGCCTTATTTCAGAG
ACCGATAAATCTTAAAAGAGATCAAAGCTATAGTTAGGGCTGACGGCATACTGTACCCTG
CAGGCATATGCCATTAGTTTATTTCCCTGGAAAAGATGGAAATAAGTACCATGATCCAGA
GACACACAAAAGAATTTCCAAATTGAACAGCTCACTGTACAGATGCCTCCAGACTTTAAG
CCAGGCTGACTTCACCAGCCTGCCTCAGACGGGGGTAGGCATCATCCCTCCAACTACCCC
CCAAAACCCCCGACAGCTGCTAACTTCCAGAATCCAATGAAAAGTGCAGGTACCAAGGTT
CAGTGACAGCAAACTCCAGGCCGCAAGGGATAGGGGATGGGCTTGTTCCTCTTATCTCGC
CCCCCCCACCACACACACACACAGTCCCCATGGGACCCAGGAGGTCATGCCCACAAACTG
CCTCTGGCTGCTACTTAAGCTCCTTAATGGCCATGATGCAGAAACACACAAAAGAATCTC
CTAGACTAACACTCAAGAATAGTAGAGTTAAGTACCAGGAGGATTATTCCACAGCTTAGA
AGCTGGCCTTGCATGCTGGGGGAGAAGGCAGCTCAGACAGAGAAGGGACCACCAAGTAAA
GGGTGCTAGGAGGGCCTGTTCTGGATGGGAGACACAGGCTGAAAGTAGACTATAGACCGA
ACATGAAGGCCACTTAATACCTCTACTGCAAATCACAACACCCAAAAGGAGAGAGAGAGC
AAAAGGGAATGCCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved