Sorex_araneus Locus Mono:220:SNORA2
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:220:SNORA2
Sorex_araneus
Mono:220:SNORA2
scaffold_166521
SNORA2
1001..1137
2137
GCTGTACCAGAGTGCCCACCTCCCTTCTCTAATGTTCTCAAAGGCCCTCCCTTTCAAAC
ACTCCTACCCCTGTGAATTCAGTTCTGTGAGTTGTACATGCATTTCAGCTCTTTGAGCCG
TTTGGCTTGGCCCAGAAATTCCATCTTACAGCATTATTAGATAGTATTTTATAGTTTGTG
AATTCACAAACTATTCTAACTATACTGAACGATATAGAAAAAATAACGATGATATTTATA
TAATTCACTTAGCAATAAGTCAAGGAAATTGATTTTGTAGCATATAATAATAATTTTATT
AGCATATAATAGTAATGCTCTTATTCTTTTGTTGGTTTAAATAGTAATGTTTTACTATTG
AATGTATTCTAATGTCTGTGAATTCTAATTCTAAAATAATTTTGTAGACATACGTATATG
AACTTGGACTGGAGCAATAGCAGCACAGTGGGTAGGGTATTTGCCTTGCACGTGCTGACC
CGGGTTCGATTCCTTCATCCCTCTCGGAGAGCCCGGCAAGCTACCCGTGGCATATTCGAT
ATGCCAAAAACAGTAACGTCTCACAATGGAGATGTTATTGGTGCCTGCTTGAGCAAATCA
ATGAACAAAGGGAGGACAGTGCTACAGTGCTACTTATATAAACTTAAGCCCATCATTTAG
TTCTTATACACAGGCATTTTTGGTGTATATTTTTAAATTTAATTTTGGTGTATAATGCTT
TAGTTTTTACAAGTCCTTATTCTCAAAGAGCAGCCCAATAAATTACACACATTTTAATCT
TACCTAACTTCCTGAGCTATACTGTCTTTGTTTATTTCCTTTAAGTTCTTCCAAATGCCT
CATTCACAGGTTAAATATGTGAGTACAGAGAATATGCCATCTTGGTACTGTCTGTCCTGC
AGCTTAGTGCCAGCAGTTAGCAAATTTGTGTTGATTGCTTTCTTTGTTAAGCACTGGTGA
TGTCTGCAGAGGTGTACCTGACCTCTCAAGAATATCATCTGTTGGCCCTGAATCAAGGCC
AGTTCTTTGCTGAAACTGTTGGTTTCAAGCAGTAGCCTAAAGAAATATCTTTCTATGGTC
TGTTGATCATTTCAGAATTTTGGAAATGAAATGGTCAGTTCATTAGAAAGAAACATCTGA
GAAAAAAAACATACAGAACGGGAGACAGTAAAAAGAGAATATCATCAACAGGACTGCCAT
ACTCAGCTCACTATGTTTAGATTCTTTTTGGCAGTTTAGACATGTTAGTTTCAGTTTGTT
TTTGTTTTCTTTGGTGAAAGACAAGTTAAAAAATAACCCATAAGCTATATCTTGGAATCA
ATAGTTTTTGCTTTCAGATCACTTGATAGATTTATTTGCTGTATGTTATGAGTTTTTTTT
CTTCTCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved