Sorex_araneus Locus Poly:14:SNORND104
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:14:SNORND104
Sorex_araneus
Poly:14:SNORND104
GeneScaffold_7288
SNORA76
1271..1402
2402
AATCATGAAAAAAGCATTCTATTGAATGCCCTTACTTGGCTATAGGCAAGCGTTCCTAC
AGTTCCAGTCCTTGGAAACCTTGATTTTCATCCCTATATTCATCTTTTTCAGGTTGTCGT
GGAAAGGGAAAAAAGTACCTTCTGAATCTGTCTCCTTTATTTATTTAGGTTTGGGGGTCA
CACTTGGTGATGCTCAGGTGATGCTTACTCCTGGGTCTGCAGTTAGGGATCACTCGGGGG
ACCATATGGGTGTCAGGGATTAATGCAAGGCTAACGCCCACCAGCTATGCTATCACTCCA
GCCCCTTATTTAAGCATTTATTAAAGTGTTGCAATTCAGAGTTCACCTCCCAAATGAGCT
AAAACTGACATTCATTTAATCGTCACAGCTTTGGGGAATATACCTATTTTTCAGAAATGG
AAATTCAGAGAAGTGACCAGGATATGGAACAAATGTGTCACAAAGTCGGCATTTGTTTGC
TCACCTGCTTAATTTAAAACACAAGATTTTTCTCAAGTGGTTATTTGAATTCAGCTTAAT
TTTGTTCAGGTTTCTTCAGCTCCTAGCCTAGTTTCTGGCACAGAATATCTCAAACAAGAC
TGGCATTTGTGGCCTCCTGCTGTTTGTAAAGTTTTCGTGTTCTGCAAAAAGTTGAACTGA
TTAGCAAGGGGCAACAGAGAAGACGAAAATCGGCAAGGCTGGGAAGAGATCACGTCACTC
CCAAGCTTTAGTTGACATATCTCTATGGTTATTACGTGACTTCTCTAGACTCTGGAGGAC
TCAACTAGAGAAAGCCAATCACGAAGTCAGTTTCTGTGCACGTGTCCGGAAGTCGAATCG
CTACTGGTCAGCAGTGGGAAAACCCGCCCTACCACGTCCGGTCTGTTCTTTTAAGTGAGG
GCCGTACGGCGCGCTCGTCCTTTCTGCGGCTCTGCGGAGGTGAGTCCTGCTGCTGCGCGG
TGGCCGGCTGGCCCGGGGCGGGGGTCGGCCACCAGCGGCCTGCCGTGATGACATTCCAAT
CAAAGCACGTGTTAGACTGCTGATGCTGGTGATGCGAACAGAAGTCTGAGCCGGGCCGCG
GCCGCCGCTGCGGCCGGGAGGAGCGAGGCCCCGGGCGCCCGCTCACGCCGTCCCGTTTGT
GTTTTGCAGATCCCGCCGGCCGAGGACGTCGGTTTCCGCCCCTCCCCAGAAGACACCCCT
CCCCCCTCCACACGCCCCCGGTGGATAAAAAGCTTTGACCCCAGCCTCGGTGTCGCGTCG
TGAGTCGCGCCGCGCTGCCTTTGAGCCCCCGGCGCCTGCGCGTGGCCCCGGGGGTCAGGC
TGCAGCGCCAGAGCACGGGCTCGCGCATAACTGGGGCCGCCAGCCCCCCTCGCCGGCGGC
CCTTTTAACCGCGAGCGACACGCCGCCCGGCTTTGGGTCTGGGTGTCCGGTAACCCCCCC
TGGGGGAGGGCCCGCACGCGTATGGCTTGGGGGATCCGGCCAGGTGGGTGCAAGCCGCGG
ACTTTCCCGCTGGGCTTTGCGGGCCCGAGTGCGATTCAACTTTCCCGAGCTCGTGTTTCT
CCGTTTAAACAGCTCACGCTAAACGGGGTAGCTGAGAAGTCGTTTTCTACCACCCAAGGG
GCCGTACAATGCCTCAATCCCGGCCTTCCTGGCCCCAAGAATTGGGGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTGGAGGT
AAAATGTCACCCACTAACCAGGATTTAAGAACAGTACACCCACTGGAATGGTCAGTTGAT
TTAAGTCATGTTTTAATGGTACAATTAGAATCAAGGAAGGGTTCAAATATACTTTTTTCA
ATATATTATTTTCTTTAAAGTCATTCAGGCAAGGTGCTGTTTAAAAAAACCATTATTAGC
TGTCCACAGATGTAAATTACCAAAAGAGCCAAGGTAATCTTGATGTTGAATGCAGTTCTA
AAGGATTTCTTTTTGACATTTCAATGCAAATCAAATGACTGGAGCTCTCACACTTGTAAA
CTACATTATGACACAAATGCACGAAAGAAAGTTGGCAACGTGAAAAGGTCACACATTGTG
AGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved