Sorex_araneus Locus Mono:784:SNORA26
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:784:SNORA26
Sorex_araneus
Mono:784:SNORA26
GeneScaffold_2528
SNORA26
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACATTTTTTAGAAGATA
CATGCCTCACTTTCCTTGGAGCAGGTATTTCTCATATTCAGCTATTAGGAAGTATTTATT
TGTGGGGCTAGAGCGAGTGATAGGGCATTTGTCTTACAGGTTCAATCACTGGCACTACAT
ATAGTTCTCTCTAAGATCAACCATACCTTCTGACTCACTGGATGAGGACTAGGAACTGGT
CTTGGAGAAAAATCTTCATCTTCAACACCAGAGTCATGATCACTTATTGGCATTTTCCCT
GGAGACAATTTTTGGGAAGACCTAAGAGTAGTGGGGAGACAAAAAGTCTTCAATAATCTA
GTTCATTCATTCTTTCTTTTTTAAATGGAATAAAGTGCTTTAATATGCTACCAAAGTATC
TAGATCTTTTATCCTGTTATCCAACAACCACAATTTATTTTATGTTTTAAGCCAAAGTTA
GCTGTCCAGTGAAGCTGGTCCAGTCAGACTCACACTGAATGAACTATCTTTTAGATTCAT
ACTTAATGAAACTTCCCTCATTGCCTAATTTTGGTACATTTAAAAGTTATTCTGAATGTC
AGAATAAATCAAGACTGTCACTGAGCCACCCTTTCCTGTCTGTGCCCTCTTAAGGCTGAT
GGTGCTTTCAGAGGTTAACACAGAAAGGTAAAGTAGTCTCCAAAAAACCCAGAGAGGAGA
TTGTACAAACTCCTCCTTGGATCCTGTCTGAAGCCACAGCTCTCCTCTCTGCCACCAACC
CTCCCGCTCTTCCCACACCCTACCAAAAAAAAACAAAGAACATCACTGAGCATCTACTGA
ATAAACTTTACCTTGGGGAATTTATTAAAAATAAATAAGACACAGGACCAGCCATCAGAA
AATTTACAATCTGGCAAGAAAATACACTCACTGTATCAAACAGTATATTTAAAAGAAAAT
CAATTAAGGAATTACATTTTTCTATGACTTTGTTATCTGTGATGGGAAAACACGGAAAAA
CTATCTAGGACACCCCCTCCCATTGACATTTAATTTGTCACAGTCATTGTTACAGGTGAC
ATGGCCCAGGAGGACAAAGTCAAGTTTCAAGAGCTGAAAATAGTTTAAGACTGAAATTTA
AAGTAAATGCATTAATAGGAAGGGTTATAGAAGAGCAATGAAGGGCCAGAAGCTAAGAGA
GCTGAGACATTAGTGGCATCCTAGCCAATCTAAGGGAGTCCTAGCTTATCTCTCTAGCCG
GAAGAACAAAAGAACCCTCAGCTAGGTCAGAAGATGTCCACAGAAAGGCCTCTACTCTGA
ACCCTGTCAGCTGGAAAGAACACAGTGGTATTTCTGTTCCACAGCCCTGCAAAGAAATAA
ACCAAATGTCTAAAAGATGTGTTAAAGCAGAAAGGTATGTAATAGTAAAGCAAAGTTCTC
CCTTAAAAGAACAATATGGAGAATTCAGAATAAGAACCCAAGTACCTCTGTGCAAGTTAA
CATGACAAATAGAACTGGTGACCTGAAGAGGGTGAGGAGGTCACAGAATAAACATACTGC
CAAAAACTAGATGCAAATGAAGAGCAAATGGCAGTATGGACAGATAACAATCATATCATC
CTGTATCACCAGAACTTTCTCAGAATTAGTACCCTTGACATTAGATATAACACCAGAGAA
AAGAGTATTAGACAGTGAATTGGTGGAAGTTTGGATCCTCTATCCAGCTTCATTAAGTAG
GAACTAAAAACAGGAATTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved