Sorex_araneus Locus Mono:712:SNORA73
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:712:SNORA73
Sorex_araneus
Mono:712:SNORA73
GeneScaffold_2066
SNORA73
1001..1189
2189
CATTGACATGGCACTAAGAAGAAGGCTCAGTGCAGGAAGGTCAAAGAGTTCTCCTTTGA
CCACATTGCTTCCTGAGCACCACCAGGTTCCATCCCCCAACACTGGGTTGGGAGTAGCCC
CCGAGGACCCCCAGGTGTATCCCACAATCAAACAAACTTAAAAAACATTGGCGGTAATAT
GGATAACCATAGAGCATACTATGCATGATGAACAGGTCAGAGAAAGTCGAACACTGTATG
ATTTCACTCTGCATGGTAGACAGATAAATAAATTAGGTAAATAAACAAAACAGAACAATA
AAACAAAGCCTTAGTCTACAAAAACAAAACAGAAGTCACCAGAGGAGAAGAGGGAGGAGT
GGATAAATTAGATAAATGAGGTCAATTTTATAATGATAAATAGAAGGTTGATTTTTAGTG
ACATGCATAATATAGCAGTACATATAGATGTACTTAAATCTGCATGATTGGGGCTGGAAT
GATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCAGCCAACCCAGGTTCGATTCCCAGC
ATCCCATATGGTCCCCTGAGCACCACCAGGAGCAATTCCTGAGTGCATGAGCCAGGAGTA
ACCCCTGTACAACTCTGGGTGTGACCCAAAAAGCAATAAATAAATAAATAAAAATCTGCA
TGATAAAATTTACATAGTGTTATAAACCAATGTTACGATTCAAAGAGCAAAGGGAACAAA
AATTTAGTCTGGCAGTTACCTCTCAGAGAAAAAGAGGCCCAGGACACAAGGGTGACAGGA
AAACAAGACACTATCCTTTCTGGCATGGCTCTCCTGGAAGGTCACTTCTCCAGGCACTGT
CCATTGTCAAGGAGCACAGGCCTGGTGCTGAAGTGATAGCACAGCGGGTAGGGCATTTGC
CTTGCACGCAGCAGACCCAAGTTTGATTCCCAGCATCCCATATGGTTCCCCGAGCACTGC
CAGGAGTAATTCCTGAGTGAAGAGCTAGACGCAACCCCTGAGCAACGCTGGGTGTGACCC
AAAAAGAAAAAAAGAAAAAGGAAAAAGGAGACTAGTGCTCTGCCCATAATGTACAGTCCC
TTTCTGCATGTTGAAGAAAAAGCCTGGCCTTGGGTCTGTACCTGCATCTTTCTACAACTT
CTCAGTCCTGTGGACAACGACTGAGGAGTGAAACCATACAGGAAGCATGGACAACAAAGT
GGTGGCCTGAAGGCTGTGGTCTGCTAACCCCAGAACTCAAGCATCAGGATGACTGGAGAA
AAGGCGGCCTGAGAGCAAGGAAGGATGGACTTGTAGCATAATATCTTGGATTGAAAGGTC
TTCAGATTTATATCATAGTAACACATAGAAATTGAAGGTGCCTGAGTATATCATTAATAT
GCTATACACTTTGTGTTAAAGATCATAAAAAACCAGGTAAGCCTTTAAAATACATATACT
TGCCTTTATTTATTTATTTATTTATTTGGTTTTTGGGTCACACCCGGTGATGCACAGGGG
TTACTCCTGGCTCTTTACTCAGGAATTACCCCTGGCGATGCTCAGGGGACCATATGGGAT
GCTGGGATTAGAACCCGGGTCGGCCGCGTGCAAGGCAAACGCCCTACCCACTGTGCTATT
GCTCCAGCCCCAACTTGCCTTTAAATATGTATATACTCCTGCCAAGCCACATGCCATGGA
AGAACTAGGCTTTAAACTCGTGATACTCAGTGATAGAAACCTAAATTCAAGCCTCAGAAC
AGCCTGAGTAAAGGATACCACAGTATCTCAGAGCTCTGCCCAGCTCCCTGCTCTGTCAGT
GCACAGGCCTCCTGCCTTTCTCCTCATGGGGTGCAGAGCACTGAGATGGCCCCAGCTGTC
ACCAGAAGGACACAGTTCTCTTACCTTCATTCCAACCTATCAAGGCCCAAAGAGAGGCTT
TGATTGGTCAAGTTCAGGCCAGTAGCAAATTTATGGCCTAGCTAGGGTTTAGCAAGAGGG
CAGGACCGCATGACGAAGGCTCATTGATGTATCTATAGTTCCTGCATCACTGTATCAATT
CACTGGGGCCATGAAGCCACCCCAACCAAGTATGTTTCACGTCTACGAGCATATTTTCCT
TGCCAGTGAACTGAGACTGATATTGCAGCCTACTTCATGGGTGGCTGTGTCACTGATGGG
AGAGACGTCTATGCCTGGGAGCATTAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved