Sorex_araneus Locus Mono:313:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:313:SNORD116
Sorex_araneus
Mono:313:SNORD116
scaffold_190090
SNORD116
1001..1097
1397
CCACCCCGCCCCCCCACACCACTAGCCCCTCCACCCTTTGCCCCCCCGCCTGTGTAACT
AATAAATTTCACTTTACTTTCACTTTGATTGCATACAATATTTCAACAAAACTATTATTG
TTTGGAGAGTCTCTCCCCTAAAGTCAGACCTGCTGAAAAGGAAATGGTTATAGAAGGGAC
CTTCCTCAATATAGTCAAAGCCATCTACCACAGGCCTACGGCAAGCATCATCCTCAATGG
GTGTTACAGTGCTGAGAATACTACAATATATTACAATACATTATGGACCCTCTGTAACTT
AGTTGAATGCTATTTGCGTGTTAGTTGAATGCTATTTGCGTGTTACATATGGTGTTCCTT
ATGTTTCCATATAACTCTTAAACTTGTGTATTAGGGTGATGACTTTGATTGCGCTCTTTC
ATTGAGTTACAGTTCCTATAAGACTCCCCTTTATGTTGTTTGCATGCTATAGAAGAACCT
ATTTCTTACTGTTTCTTTTCAAGTCATGGTCAACATCATGATTAATATTATGCCTACTTC
CCTTTTTTAATTTAAAGTTCAGCATAAGTTAGATCACTGATAGCTGATAAAACATCCCAT
GATATTCAGGGGACTGTTGGGTGCATGTGTGTTACATGGTCCTGCATGCAGGATCCAGAG
TGTTTATGGTTTTTGTTCCAGGGCTTTGACTGGTGGTCTTCTTATCTGGACTTGCAATGA
TATGGGCCGAAATTCCTGGAAGATGTGGCTCAAGGCACACCTCTAATGCTTGGAAGCCTC
CTGATGGTAAGAATATCTTTCATTTGTGCTATCCTTACTCTTAGGATCTCACAAAATTGC
CTGATTGTGTTTGTGTCCCAAGAGCTATTGGGTTCTGTCTTATTGAGAACCTACTTTATC
CAAGTTCAGGGGCATTTCTCTGGACTGTTTTAATCTTTGTACATGGAGAGGTCATTGGCT
CACACTCCAGCCACCCACTCAGTTTGTACCCTAACATTGCTGGATCGATGATGATTCTTT
CTCTCAAAAGCATTCCTTGGAAAGCTGAACAAAATGAGTGAGAACTCAATACCACCGTTC
TCCTCGATGCTGAGGTCCAGCAATTTTCTTTGCCATGGGATGGCAGGTATGATGGATGTT
TCCCTGGGTGGTATCCAAAGTCCATTGACTTTGCAATCAACACACCTGCCTGTGTGTTTC
CTCATATGATGGCTCTGGTGGTGTCTGTTCCAACTACCAGGTATAAATTTCACTTGACTG
TTGACTATAGACTATATCAGTGTTCTCATATAATGTGGTCAGAGTTGCCAGACATATCCT
GAGCTCATATGTGTCATGCCAGTTGAAGCATTCAGATTAAATTTTCTCTTTGTGACTATG
CAATGATAATCCTATTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved