Sorex_araneus Locus Poly:7:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:7:SNORD116
Sorex_araneus
Poly:7:SNORD116
scaffold_205142
SNORD116, SNORD116
1001..1101, 4598..4702
5702
TCTGCAAACGCTCCTCATGCCTTTGTATATCCCTGCATGTGCCTGGGCAAGTTTGTTCT
CACGTCATCCCTTTTTATTTTTTCTGAAATCATAGGAAAATTCAAAGTGTGTCTATGGCT
TCCAATTGTTCCCCCGAGAGGTTGGTGACTTTGAGGCTTTATTTCTCCAATCCTCAGGAG
CTGAAGTCCTTGTGATTTTCTGAGTTAAGGTGCACATCATTTTCCAGAACAAAAACTACA
GTCTTTGTGCCACTTGATTGCCTGGTTGTACCAGTTACAGTTTCTTATTAAAGAACAGGC
AGCTATTTTTTCCTTATATAGAATTCAGTGGAAAGTAGTTAGAGTGTTTTCTTCTTCCAG
GAAGGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCTGTCTTTGAATGCTTCTTGAAGGTAAGCTGTTCCGTACTCC
AATGGATCCATATACTTCTTCCTGGCTTTAATGTATCTTGAAGCCTCTTTGAGGACCCCT
ATGCCTAGGCCATAATATTTGCTTCATGCCACTGGGGCTTTAATGTCATGGGCTTTGCTC
TATTAGTCCTGTCTAGCTGCTGCAGGCTCAACACTGTGCTTGGATCGATGATGAATACCT
CTAACTCTATGCATTCCTTGGAAAACCTGAACAAAATGAGTGAGAACCTCCACCACCGCC
ATTCTCCTCGTATCTGAGGTCCAGCACGTAGCATTCCCTGGAAAGTTGTTGTGAGGGACA
GCTTCCCTGTGTTCATATACATGCACCACTGCTTTGAGCCTCTACCTCAGAGACAGTTGG
TGATGCTGGACATAGAGCTTGGGTTTCATGGGCAGAGTTTGAGTGTTCGGATTGCTTGAT
AGTCGAAACACTAGATATATGGCTTGTCTGAGGGACAGCCTACCACACACACATACAATC
ATCTGTGAACTCCAGCTGGAGAATGCCTGAATCTTCATGTGTCAGAGCTCTTGGTACAGG
AGAGCGTTTGAGTGTTCTTATTCCCTGCTCGTATTAACTATGAAAATGTGGCTCAGACCT
GGAAGAGAGTGGTAACTTAATTTGCAGCAGGGTTCTAAGAACAGTTATTGGACAAAGCTA
GCACTTGTAGAGTTTGATGTCCTTCTAATGGTTGCATCCTAATATTTAGATACTTACAGT
GGTGTGCTATGGTCCCTTGCATTTTACAGTGTGTTAGAAGTCAAAGTGGACCCAGAGAGT
TACATCAAAGGTTCTGATGACTGCCATGAAACAGGAGCCTACACAGCTACACACTTCCGG
GAAAATGCAGCTTTTCCCAGAATCTTATTTACATGTGTGCTGTCCCTTCAAACCTGTCGC
CTAACTTATTGAAATTGTTCTAAAGGGCAAATTCTATTTTTGCCCTCATGATCCTGTGAG
AAATTCTCATGTCCTCTCTTCAGGCACATACTCATGCATTCAGCATGGTGCTGCAGACTG
ATCATGGTAGACACACTTCCAAAATAGTGTATGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACCTTAACAAAATGAGTGAGAACCTCCACCGCTGCC
ATTCTCATCATATCTGAGGCATAGCTTCCCTGTGTTTACACACATGCATCACTCCCATAC
ATGCTCACTTGAGAAACAGTGGGTGCTGCTGTTGTCAAGGCATTGATTTTGTGGGGAAAG
TCACCTTCCATGGTGGTATGGCTTTGAGTTCTCTGGATGAGAACCTATCTTTCCTGGGTG
TTGCTTATCTTTTGCACACGCTGTATTAAGTATTCAATTTTTCTGGGGTTGGAAGGTTGA
GGAGAAGTTTCTCAAATTGAAGAATTGTTATTAATGGCTGGTGTCAAGACCTAATATTTT
GTTTGTGTGATTTGTTCCTTTTGGTTATTGATGGATATCTTGTACTTTTGATGGCCATGG
TCAGTGTGGAACTCAGAGTTGGTCAGAGTAATGAAGTTCAGAGTTTGTGGCAAGACCCTT
GACAATAGCCCTCCTGTCTGCTTTCAATGTTGGTGTGGCCTCGCAGAGCAAGTATTAAAG
AATTCTGAGTCATATTCGTGCTCCTGATGCTCAATGTGGATGAGGGCAGGTAGCAGAAGG
GCCAGTTATAATTGCAGAGGTTATGCTTGGGAGACTGAGTTCCCTTTGAGCATAGCACTA
TGGGGAATCTTTTGACAGGAAGGTAGGTGATATGGGCAGGTCATATGTTTGCATTCAGGT
ACAAGGTACAATGTGATAAGTTCCTGTGCCAGGGAAAGATATTGATGACCTCTGTTCACT
GCACAGCCTCAACTGCTTGTCAAGTTCTCTAGGAGAAACCAGAAAGGAATGTGATCTCTC
CTGATGGATAGCTGCTGCATAGTTTCCAGAATTACTATGCATTTGATCACCGACCTCACA
CCCTTCTGGGTTTTCACATTGGCCTGGGAAGTTACATCTCCTTCATAGTTACCAGGCTGG
TATGGAATCTCTACCAATGGAGCATATGACTCTCAGATCCATGGAGATTGGGGTGTGCAG
GTTGACAGGTGTCCTAGTGGGAAGACTTGGTGTGTACCTCTGTGGAAGACATGCTGACTC
TGGACATTGCGATTCCTAGGAGAACAGGTTGTCAGAAGAAATGGGGATAACTGCCCCAGT
GGCATCTGGATTAGGAACTACCTTCCTTGACTATGAAGGCAACAGGAGAACTTTAAAGGT
TGGGCCTCACATGCTCTTGCTCTCTTAAACATCCTCTTCTGCAGCTAGAATGTTGAGGTA
CATTCCTGGGTCTGCTCAATCTTGGCAGTTCTTTTTCCCATGGACATGGTGTCTTCTAGG
TAGGAGTGGTATGGAAGTTTGTTGTTTAAACATCACATTAAGGCATGCCCCATGTGCCTC
CGAAGGTTTATTCATGCATCTGGTCAGTCTTACTCCCACATAGTCCCTTGAATTTTTCTG
CAACATATTGGCCAAGATTACCCTAAGCTCTGTGCCATCTACTTGCTCATTTTGAGCACT
GAGACTCAGCATCAGGGTGCCCACCCTTGCTCCCTGGACATTCAGACTGAGGCTACTGAG
ATGCTTGAGTTGAAAGTGCAAGGAATCCAGCACTGTCAAAACAGCTTCCTGACAGTATCC
AGTGCTTCAATTTCTGGTGTGGTAGTCAGCCATTATTTCTTAATCATGAGCAGCATATAC
AGAAATCCCTGTGCCAGAATATTTTTTTGGCTAAGGGTCAAAATTGATAGTGCAGCTGAA
GAGAGATAGAATATTTCCATTCCTGGCAGCAGCAGATATGTACTATGTACAGTACTATGT
CTCCTTTGTATGTTGGAGCTGAATCAGAAGATGACAGTTGGCATCCTGTAGTAGAGATTT
CTGTCTCTTCTAGTATGCAAGCAGGACCCAGTGATGCCTGCTAAAGTGCTTATTATCTGG
ACACCAATGAACGCTACACAAATGTACTCTCACAGTAACATGCACTTTATTCCTGAAGTT
CAGAATACTGGTCCTTTGTCCCCATTTCTTTTATCTGACTTTATTTCTACTGGCTTACAA
GGTCAAATGCTAGGCCTGACCGGGGGATGTCCTGTGGCTGTGTCTCTTGTGCCCAGTTCC
CAAAAACCTTATGGTTTTCAATGTTTGTTTGCACTGCTTAGGTGATGTTTGCCTGCCAGG
CTTGCTGATCACAAAGAAGATCTTCCTGTCGTTCATTGAGCTAATGGTGGGTGGGAGTCC
GAGGTTTGGTTGGAGCAGTGGATGCTTCCAGAGGTAAGATAATTGAGCACCAAAATGACA
TCTGCATTGTTGTTATTTGGAGAACCCTCCTTCTTTGGTATGCACTAATAGCTCCATATC
GCTTGCTGTTTGTATTAGATAGTTTTCCCATTGTGCTTGGATCAATGATGAGTACCCCTA
CCTAACTATATGCATTCCTTGGAAAACCTGAATAAAATGAGTGAGAACCTCCACCACCGC
CGTTCTCATCGTATCTGAGGTCCAGCACGTGGTTTGCCCCAGGGACGGTAGGCATGGACA
TATCCATGCACCATCACCACTCTGAGAGCAATAATCATCTATGTTCAGGCTCTTTATTTT
CAAGTATAGTGGTTCAGTGATCTTCACTCAGTCTTGTATGGTAAACGACAGCCCTGTTTT
CCAGTGTGTCATCTTTGCTTTTGGAGCAACAGAACCTGTTTTACCTGGGCTCTCTTTAGC
ATTTAAAATTAGTCTGATGTACAGGAATCTTGTGATTTCCTAATTGATGGTTACTTATAG
AAAAAAGGTTCAGGTAGGAGACCCGGGGAGTTGTTGTTTTGTAGCATGTCTCAAGAAAAT
GTAGTTGATGGCTGCAGTCGGCACTTAGTGGTGTCTTTCAGGTATTTTGGAGGGTTGGTG
TGATGCTGAGTTTGCTAGAAAAATGACACTCAGAAGGTATGGTCATCCCCTGGGCAGCTC
TGCCTGTTGAATGACATCCTGGCTCTACCTGGGATAATTTGGATTAGGCTCACTGAGCCA
CACATAAACTGCTTGTGGCTGATGTTGATGGCAGTAAGGGAAGGTCCCAGAAGGGTCAGA
GGTTATTGTAGAGGTTGATCCTGGATACAGAATACCTTTGGTTCTGGCATTAGTTAGGTC
TCTCTAGAAGAGGAAGCTAGTGATAGTCACAGTTGGTGGTTCTCATCATTGAGATGCTGA
GTGATTCTCATGCTTCTACAAGTGGTGGTTGACCAATGGTCCAGTGAAATCCCTAGGACA
ATAGCTACTAATTACATTAGCTACCATTGGTGTGTCTAGGAATATAATCAGTCAGGGTTG
ATGACATGCCATTTTTCTTGGGAGGTGCTGCGGTTTTGACTTCTGGCCTCAGGCTATCCT
AAGTATATTCTATAGCCCTAGAAAGTATGTTTTCTCTTGAGGGCCTCTGATTTTAGGAAA
TCTCAGTGCTCTGACAGCAGTTGGCTCTCCGCAGATACTTAATGAATTTCCATCTGAGGA
TCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved