Locus Mono:snR46
snOPY snoRNA Orthological Gene Database
Mono:snR46
Mono:snR46
III
snR46
1001..1169
2168
TTTGGTTGAAAGAAGAAAATTCACAACATCCTAAAATTAAAAAGGCACATAGGCATTTA
GAACAGTTGAAATCGTTATTAGAGTCGTTGCCCACCAACAATGAACTGGAGGAGACCGAT
GCTGGGTTTGACTCTTACTGGAACAAAATTACAGCCAAAGCCAAAGTGGTATCGAGTCTT
TTAGGAACTAAGATTCTTCCCGCTGAAAAAATTGATGCTAATGATGGCTTTGAGTAATGT
CTTCAGAGCAAATATACTATGGAAGGTATTTAATATTCCTGAAAACATTCACTTTACATG
ATTGATTATGTTATATTTTAGCAGATTATATCTGATATCCTGGCATTTGTTCTTTTTCTT
GACAATATCTCCCTTCGAAAGAAAGCTGCATGTAGTGAGTGAATAGTCGTTTTTTTTTTT
GGCTAATTCATTCTGAATGGAATCAATTTCTTCATCCGTTATGGTTAGAAACGTTTTGGA
AGCTAAATAAAACATTTTGTACATTAAGATGGAAATTAAAACCGCAAGATCTTTTTTCTT
GTCAGCCAAGTTTTTCCAGTTAATGAGTACTAGCATCTGTCTCTTTTAACTCTAGTAGGT
GTGTTTGACTGGATGGCATCCCCATAATATTGCTTTGTTCTTATGGCAATTTGATGATTT
CATTAATGTTCGTAGAAAATAAAAGAAAAGGATCAAATATTAAACATCCGCTTTATGATT
GCCATATGCGTTCATGAATTAGCACATTAGCTGCTGCTGTGTATATGATAATCCTATGTA
TAGACATTTCCCCGGCATAATTACTTGCTTGTCCAGTTTAATAAGTTTGTTGTACATTAG
AACAAAAGTTTATAGACACAAAATAAAGACATCGTAACAAGTTAAACATCATTACAATTC
CCCAGTTTACCATACAATTAATGATTTAAAAAATAAAAATAATAAATATTCATCGACTAT
ATAGATACCAGGATAGCAATAAATAAAAAATTTTGTATGTGAAATGTGCAACTTTCTAAA
AATGTATTATAAGCCTTGATTTTCGTTCACTAAAGATTTCGCGAAACAAAGCAAAAATAA
TCGTTACCGGCATTTGCCAATTTTGTAGGCCTATTTTTGACTTTTCTAACTGGTAAATTG
CAGCTAGATAAGCTTCGATAAGGCCAAGGACAATGGCTATCAAATGTTGTTTCATCGTTT
TATTCATTTCAGTTAACAGCAACCGTTACTACAATTCAAGTTTAAGAGATATCCATACTA
AGAAGTTGTTTTTTTTAAGGTAGTTTTAATTAAAGGAAGTCCTAACAAAAAACGAAATAA
AAAACAACGTTTATTTACGATTTAATAAAAACTGGTTGTTAAATAGTTTGCGACACCAAA
ATGGAAAGCAGTATTGTTATGTGACTGTGTTTTTTAGGCATTGTAACTCGCTAATTTGTT
TAGTGCAATACGTTCATGTTCATTATACGCTATTGTTTTCATAAATAGGTATCATCTGTT
TTTTAATAGTTTTTTTTTTTTGCTTGTTTCCTTGTTTAATATTTTGCTCTAATACTTTAA
AATTGAAACTATCATGTACAAAATACAGGCGGCCTAGTTTGCTTTGTTACTAATTATCAT
ATTCTTGAGCTTTATAAGAACACTCTTGAATTAAGCAAATTGGATAATTTAATATACAGC
GACTGCTTATATTGATTTTCTCTTTGTTTTTTATATTAGGACCTTTCTAAATTCGATAAT
GAATCACTTCTTCATACCCTACATTATATTTGTGTTCATGAGTATTTGAATTCATCTTAT
TTACAATATTCAGAATAATTAAAATAAAAAATATAAGACAAGCCTGCCCAACATATAAAG
AAAACAATATTTGATTATTATTTATTCGAGCTTTTGTTTTAGACATAATATTTATAATTT
ACTTAAAAATTTAATAAAATCATTGAACTTTTCTCAATAAATTGACGACATTATTTAAAA
AAAAAAAATAAAAAAGGTCTTGTAGTATAAGAAAAATAAAAAGATAGTAACAATAAAAAA
ATAAAATAAAATTAGCGCCTCAAGTCATTTCGACATGATTACAGCTATCCCTTCTTTCAT
TTTATATTTTTTACTTTTGATGATTGGCTTTTCCAAACAATAAATACCAATTTTAGCAAG
AGCAATACG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved