Locus Mono:snR10
snOPY snoRNA Orthological Gene Database
Mono:snR10
Mono:snR10
III
snR10
1001..1168
2167
TTCACTCTTTTTTAGATTATACGCAACTCATGACGAAGAAAACAACAAAGAGCATGAAA
TTGAGATGACTTGGGTTGGTGTTGAAACAAACGGTATTCATACACCCGTTCCTGATGAGC
TTTTGCAAGAGGCTGAAGCATATGCTCGTCGGATTGCTGATGGCGAAGAAGAGGATATTG
CTATGCAAGAGTAAATGTCATATGATTCCTATTATACTATGTTATGATTTCCCATTTTTA
TTCTCTCTTCATGCCTTTTTATTACCCTACTGACCTCTTCCTCTCCTTTTCTTATTTTTC
CTCCAAAATTTTAGCCAAGTCTTTGTCTCTCGATTAGCTATTCCATCTTCCGTAACCGTC
AATTATAAACAATTTTACGAGAACGATTATCTATAGATTCCTTTTATCGCTTTTCTTATA
GAATCAATACACCCGTTTAAGGAATTAACATTTTTATCTTGTTAGAATATGGCAGATTCT
ACTTCCTTAAATCTTTGGAGTTATAATCTTCTTCCCAACTTTAATTCGGGTCTATCGATT
TGATATTTAATGTGTATATGTATTGACCTATTTACTACATTTTCACAGTGATATTAAACA
AGTAAACATTTTTAGCATTGCGTGAAATCCCTAATAACAAGTAGAGTATACTTTTGAAAG
TGTATTATGATATCAGCTGTATGAGAAAGTTATTTGCAACCAATGCAATACTCATTTTAG
CTTACAATTTTTTTAATGCAAAATCGTAAACACGAAATCGTTTAATAATCATACACCGAA
CTTACTATTGAGTGAATTAACAAAAGCAAACCTGCTGAAATACTTCACATTTCTATTAAG
TACCAATCAATTTAATTTTACAACTACAATATCCATTTCCTATGCTCCCAATTAAGACAG
GAACACCGGATGGCAATCACTGACTATGCATCAATGTCAATCGATAATGTAATTCAATAT
TAACAACTATTCCAAAACAAAAAACATTCTTAAATCTAATTTCATGTAGTGACAATTATT
GAGATGATTATCATAAAAAAAGAAAACCATCTCACCCAATCGTCTCTTTTTATAAATTTA
GTCTTCAGTTCAAATTATCTTTTATATTACTGCATCAAGTTTTGAATCCGCAGCACTTTT
ATTTTGACTGTTATAATAAGCGTTGTTCGTAGTTCCCTAGTAAGAAAATTCAGTATTTAT
ATAGCACATGATCAAAGGCAGTCACATTCCTTAGGGTTTTTTAAACTGAAAGAACGATTT
GCCGCAATAATTCGCAATTTAAAATTAAGTGACTTACAAAGGTTCGGTATTTACTAAGCA
AGCTTGAAAGAATCTTTTAATAGTTTTTTATTGCAATGTTTACTTTTTTTCAATATACGG
TAAATTTCTTCAATTATCTAAACCAAATAAGCATGATGAGTGGCAACGGTAAAAAACAGT
TGTGCGGTTACCATACTTATTGTATTTGCCATTTGTAAACCATGAGTTGCGGCTTCTTGA
GCCTTTATTATAAGGAATTGGGTTCGTTACTCACCAGACAAAATAATTAATTAATTCATT
TCTTTCCCTAATATCTAATATCTATTTCTAATTGATTAAATAAATAAAGGGGCCTAGTAT
TCCTTAAAATGCCGGTGAGCTTGAGATTTGTAAGTTTTATTGACCGCTTCTACCCAACAT
TACCGCCGATTTTGAATGGGGATGAAAAATATAGAAACCAACAGATACAAGAAATTGGGT
AATTCTCTCGCAATTAAACGAAAATAGTAGTAAATTAAAAGAATTAAATTGTTAGGATGC
TAAATACTAGAAGAATGACAGTAGGGTTTGAAAAGCTTTGGTAGATTCACATGAATTAAA
TAGTTCACAGTATCAATTGAAGAACATTTGGGAATATGCTCTACACCATCTCACTGCTTT
GCTAATAAGTGCCCAAAGGAAAGATAGAATATTTATAAGGATCTATGTAGAAAACGATTG
ACGAAAAAAAGTGGGAGCAGTTGTCTTAACAAAACATCAAGCCTGTTCTATCACGTTTGG
AAACAAATGAACGAAGATGAGATCTCATTGAAGACGAAATGTAAAAGAAAATTAAAAAGA
ATACATTCTTTGAGAATTACAGAACATCTTAAATTAATGCTTATGATCAACGTCCTTAGC
AGCAGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved