Locus Mono:snR94
snOPY snoRNA Orthological Gene Database
Mono:snR94
Mono:snR94
III
snR94
1001..1211
2210
CTTTTCAAAAGTCATTTGAAGACAAAAACTCAACGTTGAAGAGAGCATTTGTTCATCTG
TTGACTTTTCGCCAATACACCTGTTTTTTTATGGACTTGCTAAGTATAGTGTAAATTTAA
CGCTGTCGTTGATCCGTATGATTTCTTTTGATTAATTTAAATCGTTATATGTGACACTAG
CAATTTTTGCTTCATGGCGGAAGAGACTGAAGAGGATTATTTAGTTGTGGGTCGTGATTA
CTTGTACCCCCCAGATCATGAACTGCACTATGGGTTTCATGCTCGTGTGATTGAAGAGGA
GGAGGAGCGATTTGTAGATGATACCTTTGATGAAACAATCGAAGGATCGGATGACTCCGA
ATCAATAGATGATACGGAAGTATTTTACGATGCTGAAGAATCTGAAAGCACTCACCCTTC
TGCTTCTTTCAACGTCCTTGCTGACGCCGTTGCGCTTTATGATTTCGAGCCCCTCCATGA
TAATGAACTCGGTTTTACTACTGGTCAGAGACTTTGTATTTTGTCGGAATCCAGCGATGG
TTGGTTGATTGCATACGATGATGCCTCAGGAAGAAGCGGGCTTGTTCCTGAGACGTTTGT
TAAATTAGAGGTATAAAAGAGCGTTGAATTGAACCCTTTTTACTTTTTCTTTTTGTCAAA
TTGATTTTAAAATGTTATTCCTTATTTTATGTTCCAAGATTTTCTGGATCCTCTCCTTTA
TATATAAGAATCCGAAGTGTTACGGGAAAAAAATTCGGATTGTCACGCTTCTTATGAATA
TTATTTAAATGTACGCCTTTAAAGCAACTATCATACAATTCTCCTTTGGGTAAATAACTA
ACCTTGGGATGTGTCGTAACTTGGGACTTATTTTTGATTTGTTATAAGGATGAAATGAAT
GTTCTATCTTATGGACCTTACAAGAAAAACTATAATATTGTCAAATATAATCATATGAGA
TGAGTTAAGCTACATAAAACTCTTTGAAACTTTATTTTATATTATTGCAACCTTCTAATA
ACTTTACATCTTCTTATCCAAAGAAGAAGGGTTAGAATGTACCGTGTTTTACGGAAGTTC
CATTCCCGTAGGGTTACAATGTGTTGCTAGAATAAACCGTAAGTCATAGTACATATAGAG
GCCAATTCTGTAAACTTTTTTAAAGTCTATGGAAAACCCTCTATGTGTCTCCAATAGAGA
ACGGACATCTCTTTCTGATTAGTATATACGTTTTCATAGTCTCTTCATCCTGAGGTAAAT
TGTACAAAACGCTGTAGTTAAACATGTGATCGAGTTAAATAGATATCTTCATAGTTCAAT
ATACCATTAGATTTTTTTAAACAAAATCATAACGAGTACGAGGTCGTTTTGGAGAAATAA
TATCTGCAAATGCTGAACGTTTTCTTGGTGTGGAAGGATTGGAAGACGAGGATCTTTCAT
TTAATGCTTCCTTGAACCAAGTCTTGTCATTCAATAAAGACTTTTGATCACGAATAATGG
ACATTAACGATCCTGGACTAGTGTCGGTTTCTGACTCGAATAAGTGATGATTGATAAGAG
GAAACCATACCATCTTGGCAATCGTCTCTGGTGGAGTAAGCCAAAGGGTCCAATTCCATT
CTAAGAAAATATCTTTAGCTATTTTTGAGGTACAGAAAATTTTTAAAGATCCCTCGTCAT
TTGAGCCTCGTAGTTGAATTCTACTTTCAGAAGAAACATTCACCAGCACTTCAGCCAGTA
CATCGACTAACGTTTCAAACGTTTGAAATGGATCGATAGGACATCTTTCGCTCTGTTTAA
AAGTTAATATAACTCTTGGTTGAGAGAAAGGTGTTAATTTGGTTGCATTTATAACTGCTT
TTCCCCTGAAAGCATAGTAGCAATGTAGTTGTTAACTAATCTTACCTCTGCCTGATTGAC
GATTTGATTGCGGCTACATGTACAGGACCAAACACGCACTAGGTCTGTAATATGAATGAC
TTGTACAGCCTCATTACTTTCTGCGTCGAAGCTAGCCTGTATAAAATGAAACCTGTGGCC
ACGTAGCTGCACCCAAGACATCAAGTATAAACAAATGCAATGTCTTGTTCAGTATCTCAA
ATTGATTATAACAGCAATTCAATTGAAAATATTAAAGCTAAATCACTAAAATAGAAGAAA
TAAGCTCAGCAATGGTCACAGTTGAGAATTCGAGTTTGCAAAGTAGTATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved