Locus Mono:sno12
snOPY snoRNA Orthological Gene Database
Mono:sno12
Mono:sno12
III
snR99
1001..1191
2190
ACCGAAAATTTCATCTTTGAATACTTTGAAGTGTTTGTATTTTTTACTGTCATTAACAA
AACCGCATTTGAAGTAGCAGGTTAATAATAATGACTGTTAAGACTGCGGTTCATAAAATT
TAATTATTTTGCTTATTGTTTTTTTCAATTTCTTCTGTGCCCCGATTAATTAAGGTGTAT
CCGACAACCAAGGTTTGGATGCTCGATTATGTAGGCAACACAAAAATTTACATGATATGG
ATAGATCTTTCATAGAAATACCTCTAAATTTTGATGAATTTACTTTAGCAAGAAAAAAAA
AGAATGCAATGTTAAAAACTGTTACAATAATTATAAATATACAATGGGTACCAGAAGTCG
CTATGAAAACATCTGAAGTAATAAGATTACGATCAACAACTCAAAACGTGCAAATATACT
CCAATTATACTAAATTCCTCTCTTATAATTGATATACTGATATTAATTGCCTCCTCAAAA
TACTTAGCAAACGCAAGCATTATTCCAAAAAAAAGTCGAGACGAATAACGAGCTAGACCA
CTGTTGGCATGCATTTTAAGGCAATGCGGTATACAAATTCCTCAGTATATCAAAATAAAT
AACATTAGAAAGAAAGTACTCATCTGGGAATTTTTTTTTTTTAATTCACAACTATATTTA
ATAAATATTTTAAATTAAAATCAGTAAATTGCTATGATGAGGTTAAAAGAAATAAGAGAC
ACGATTTGAATTGTACTGTTATCGAATAATTTATCAAGTTAGCATGTTAAAGTTTCCACG
ACAAGTACCCAAAAGTCTGACTACGTGCTATTAAAGCTAGCTAATCATATAAATTAAAAT
CAGCCAAAACTCATAGTCATTTCACAAGTTTCTCTTTTCAGCCATTGTTTACATATGAAA
TTTTACTTAGTCTCCAGAACATCGTTTCTAATACCCTAACCTAAGGTAAAAACCGTCACA
ACAAATTTACTATATATAGGGTCTGTTCAGTTGATGATTCACCATCATCAGTAGGTTTTA
ACTTACTTTGTTATATAAGTAAAGTAAAATCAATCCTGAAGTCAAGTATGATGGTTGGAG
TCTCCGGACCAAGAAAATGCATCCGTTCCGTCTTCAGCGAAGAATTGAGTGGCTTTCCCG
GTCGTTGACTTTTTTCCATGGGTCAAGGATGGGATTGTCTCCCAGACATTTTTAATTAAA
AAAAGTTTATATTTGATTAGTTTAGATACGTACCCAAAGTTTGCAATACTACATGATTTG
TTTAATAAATTTACGGTGTACTGTAAAACAATTCGTAGAGCCAACAGTATAAATATCCCA
TTGATGGCTGGGTTCAATAGTTTTATTTTTAGTGTAAATATAATGACAATCTGTTTATCA
AAGTATACTGAGATTATAATATTTGTTTTTGCCAAATGGTTTTATAATTATTAGAGCATG
ATAAAGACGATGTTTGAGGAATTCTTCTCACTATGAATGTCTGTTTTCATGGAGACGTGG
CATCAAGTAATGGTTTTTAGAGGCATGTTCAAATTTGTTTTCGCTCATTGAAACTTGTTT
TCTATATCGCTGTTCATGAATTTTATTTTATTTTTTTTTTATTTCAGACTTAAGAGTGCG
CTAGATTTATTTGGGCATCTTTAAATAATGTAAATTACTTATAACTCCAAAACTTTTAAC
TTGGCAATCTAGTTTGGGCCATTGTGTAGTTGCCCAAAACATGTCAGAGGAAGTAGTCCA
GGATGCACCTCTCGAGAATAATGAACTCAATGCCGAGATAGACTTACAAAAAACAATACA
AGAAGGTATGATTAAAGGGAATTCTTCATTAATATATATTATTATGCCGTAATTACTGAC
GATTATACTCGTTTCAGAATACAAACTTTGGAAACAAAATGTTCCCTTTCTGTATGACTT
GGTAATAACCCACGCTTTGGAATGGCCTTCTTTGACAATTCAATGGCTTCCTGACAAAAA
AACGTACGTTGCTTGCCAAAGTAGTTAGGCTATGATTATACTGGCCTTTACTTCAAACCA
TCTCATCAGTTTTCTAACTCGATTCTTGAAGAATACCAGGTACTGATTACTCTATTCAAC
GTCTTATTCTTGGCACTCACACATCTGGTAATGATCAAAATTATTTACAGATTGCTTCTG
TGCAATTACCAAACTTTGATGAGGATACCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved