Locus Mono:snu32
snOPY snoRNA Orthological Gene Database
Mono:snu32
Mono:snu32
II
snu32
1001..1256
2255
TATGACAACTCGCATTAATGAATTATTTAAAACGTTTTTTCGTTTCCTTAATATTTGAT
TACAGCTTAAATATTCCGTAATTTATAAATAAGCATTGTGATTTCGTTGAACTTAATTTT
CAATATTGGTTTTTACTAATGCTTTTAATTGACCAGTATATTGTAACGTTCAAAGGCTTT
TCTAGGGTTTTTGAACATGATTTTAGTAGCAAACAAAACACTGTGACATTTTTTGAAGCA
ACTAGCATCTTCCCATAAGAAAAAAATGTTTTCTATTAAACCATAACACAAATTTTTGAT
GTTTTTCGAACTCGTGTTTAATTTTCTAATTTGAAATGATCCGTTTAATTAACGCTACGA
CACTGGAAACGCTTAAAGAAAATGCTACTAATTCCATTTATAGTTTTTTGTTGCATTGAA
AAGTGTTTGCTAATACCTTCTCATAAAAAAAGAACATAAGGAAATACATTTTCTTACTAC
AATTTCCTATTTGGCAGCATGCATTTGTTTGGGCAAGTGCTTTAAATTTCATTAGGATAA
TGTCCTCATTTGAACAACACCATGGGTACCTTATCAATAATTTTTATCTCCTTTATTGAA
ATAAATACCCGGAAAACATAGACAGATCGTATTACAGGTCTGTTATCGTTAGGAGAGTTA
GAGTCAGAATCAAAAGCTATTTATTAATAGTTGTTTACTATGTAGGGAGGAAAACTTTAA
GGCCCATCTCGTGGCTTACAACACTAAAGTAGTTAACAACGCTGCACCGCATAAGCATTT
GTTGCATTATAAATTTATACCGTTGGTTTTCGTATCCCTAAATTTGTTAAGAACCTAAAG
TTTGACAACACACTAAAAAGGTTTTCGTAATTTACGATGTAAAGGTGTGGAAAATTTTTT
AGAAGGTAGCACCAATATTATTGGCTGCTTTTGCAAAGCCAAGTGACTGCTTTTTTTCAA
ATACTTACTATAAAAAGGCATCGTCCGCGATTTTGAAGACCATCGACGATACTCCATAGG
ATCATTTCTATAGTATACGTCCGGCTTGGGTTTCCTAACCTAGCCACAGAACTCAACACG
GATGATGATAGAAGGCACCGTTGCCCGCAGAGTGAGAATTTTTACTTCTTTGAGGATGTG
CTGATCGATTTGGCTTTTTGCTTAATTGTTGTGCTATCTTTATTTGCGATGATCTCTTAC
ATGATATGTTCCTTTTGGTCGTGTCATGTAGGGCAGCTGGTGTTTTCTGACGTGTTTTCT
GTACATTTCTTTGTAACAATTGTCGTGAATCGTTTGTGAGAATTGTTATAACTTGATGTG
CATAGTCAAAAAGTGTGTAGATGATGAGCTAAGCAGTATTCGGTTTTCATGTAATATGTG
AGCAGTAGGCATTGTTCGTGAATGAGAATCTGTTGTTTTTAAGTTGTGAAATAAAATGTA
GAGAAAGGTGTAGTAGTCGATTAGTTCTTTTGTGTGGATACTGGCGCAGTTGTATTGCAT
ACTCTAATTGTTTATTTTTTCTGAAATTTGGGGGTACTGCTAAATGGTAAAGTGTACGAA
GTAATAGTTGCAATGGTAGTTCTGGCTCCTTTGTGTATTCTTAATTAACCTGGTTGCTTA
TTATGCGTTATTTACTTGCTTAAACTCATTTTATGTTATATAGTTTTATTAACATTTGTT
TTGATAAGTTGAGGCGGTTAGTTAACAAAATTAAATTAACAGAAAACTAAATCTGCAATC
GTATTATTATCTGATTATCCAATTTAAAAGTTATCTTTCACAAAATCATCAACATAAAAG
AATGATTAAGGATATTAAAAGTACAATTCTTCATATGCACAGATAACAATTAATTGGGAA
GCATCTCTTGCAATTCACCATTTTCAATCATCTCCGAAACAATATCTAAACCACCGACGA
ATTCACCTTTAATGTACAATTGAGGGAAAGTTGGCCAATCGGAAAACACTTTAAGACCTT
GGCGTACAGAATCATCAGCCAATATGTTAAAAAATCCATACTGAACGTTTTGCTCACGAA
GTAATCCAACGAGCTTACGACTAAAACCACATGCAGGTTCTGAAGGAGTACCCTTTAAAA
AGAGCATAACATTGTGAGCATTTGTTAGCGTGCTCAACCTTTCATTTAGTTCAGAATCCA
ACCCATTTGGAGCTTTAGAGGTATTGGAAGTAGTGTTGGTAGTCTGAACGGAATTTACTT
GAGTTTCCACGGACGCGTTGGTAGAGGATATTTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved