Locus Mono:snoR68
snOPY snoRNA Orthological Gene Database
Mono:snoR68
Mono:snoR68
II
snoR68
1001..1074
2073
ATGTACTATTGCTGTTGTTATTGTCGTTATAACTATTGGAAGAATATGAATTAGCCGTG
GTTCCACCGACCGAATATGAGGGAGCATTGGTTGCCGTATTGGAGTTGGATTCCTCGGGA
AGCATATACATGTGCGGGCTAACACCCTTCTTCTTTTTAAACAGCTTCTTCATTCTTTAA
CTTAAAGTGCACACCAAGATGAGTCGAGAAGGGTGGCGTAAGCAAAAGTTTTAAGTTGCA
GATAGTTCGATTGAGTTACAAAATTTAATCGTCAGATGTAGGGTTTCTCAATACAAATTG
TAGAATAATTAAGGGTTAGTATGCTACTAACCAAGAAATGCAATTGCTTGCTTTACGAAA
TGGCGGCAAGTTAATCACCTTCCTCTTTAAAATCCCATAAATTATTATGAAATAAATAAC
TTGCAGAACCAAACAAAGCTTCCGAGCACAAATTATGGCAAACGGTAAGCACTGTAATCA
ATTTCCGGAACATTAACTACTCTACGCTATGTCGCGTTAAATTTCAAAACAAATATATTT
AAATTACCAAGACTTTATGAACAGTCGGCTGCCGACTGACTCTCTTGCTTAAACTCAATC
CAGTAATTTTCTGAAAGTATCCATGCCATATTGGGTTCTACGTTGGCGTTTTTTAAGAAA
GCAATCTTTCTACTTTTCATCATAGAATTTAAACAATGGAGCCATACGCTAGTGTTGTTT
TCTTTTTGACTAGCACTTTATATCAATGTTATTGGGCCATTCTATTTTTAGAGTACGAAA
GCTTTCGAAGTACATTTAGCATAGTTTGCTTACCATTAGTGGAAATTACAATTATTTTTG
AAATTTGCGAACAGTCAAAATTTTACATCCTTTAAATGAATAATTCAAAATATTTTGTGT
TTTTCTAATTTATAAATGATAGAGTTTAAAGCAAGTGTTTGTGTATCTCGTCAGATTCAG
AAAAACTATATAAACACATCCTGAAATTTTCATTAATTCAGGCATATGATGAGAACATAT
ATTTTTATCTGAAAAAAATTGTTGAATAAAAATTTATGCGTTATCTTTCTGATGCCACAG
AAGTAAATATATATTTTTTACTCTCAATAATTACAAAGACCCTTTGTATGTCTGTAAAAT
AGTTTTCCAACTATCCTTCATTTTTCTGTCTTTCCGATGGACTAATTTAGTAAGGTGGAG
ATTTTGTTTCGTTAAATTTTGAAATTTTGTTTTATAATGATATTTGTATATTTTTTGAAG
ATGCCCCGATTTACGACATAGTATCTCCTATTTTTACTTTGGTAAAAGTGACCGAGATTT
AGTTTTAATTAATTTAAAACATTAGTATAAAGTATTGAAATTATTACACTGTTGACAGAG
TAAAAACTAATTGAGTTAAAGCTGTTCCAAAGTAACTTCTGCTTTCATAATGTTAAATGA
TAATGGTTTATTATTTTTTGCTTCTAAAGTGGCAGTTTGCTAGTGTCTTTAAAGGATAAT
TGTTAAACGCTTTCCTTTTTTTTGCAACCGATTTTATATGAACAAAATTAAGTTGTTTCT
TAATTATGTGATCACATCAACATACAACATTAAGCTACATTTCTGGTTCATATTGGGGAT
TTCAAAAAATTGAATCACATGATAATTATGTTCGCAGCATAGTATCATAGGAATATACAA
ATTGCTAAAGTACATGATTTTTCTTTTACTTTAGTATGCTTTTGTAAGCTTCTGACACAT
ACTTAAATACTCAAACTCATGTGGAATAAAGGTCTTAATCGCATAATTAACATTGTAAAC
CACATAAAAGGGAAGCTCGATTTGTCTGCCTTTAATTAATTTTCCTTAACTATTTGCTGG
AATAAACAATGATCTTTTAAACGCTTCAACGATAAAAGTAATAAGCTGCTTTACAATCTC
AGCACAAAACTAATACAAATGAATTCTTTAAAACTATAAGAATATCAAGTTTTGAAGTTT
CAAATAAAATACTTTCTTGCATATTTGATGACTGGAATCATGATTAATTAAAAATGTATT
TTTTTTATTTGACTGCTTTTAAAGCAAAATCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved