Locus Poly:snoR61
snOPY snoRNA Orthological Gene Database
Poly:snoR61
Poly:snoR61
II
snoR61
1001..1109,1446..1653
2653
TTCCAACTATGGAAAACATGATCACTGTTTTAACCGAGAAACCAGAGCATAAAATATTC
GGTCTAGCGCAAGCCCAAATGTTTAATATAATTTGCAAAACTGTGCTGATTGATATGAAT
GTGTTGTCAGCCCAAAAGGAGATGCTGCATACATTATGGCTAAAGTTAATGGACGTGGCC
ATAAAATTAAGTTCAATCCATGGTTCAGAGTCTATGGCTGAGGTAATGGAATCTATCAAG
AATGTTTTTATGATTTTACACGGTGCTGGAGCACTCGCAGGACCCACTATTGAGGTCGAT
CCAGAAATTCCTGATCATCTGATAAAAACTTGGAATACTACATGGAATAACCTTTTCATA
TACTATCCAGAATTATCAAATGACTTAAATATCAACAACGAAGCCGAAATGAAGAAAGAA
AACCTAAAAAATCCCTCACAAACGACTACTGTTTAGTTTTATCCTCTTCAATTTTTCTCA
TTCTTTATGGATTTAAAGGGACTATCATTTTTCCATATATGCTCATTGAAGCCTAGACTA
TCAAAAAGTATAGGGCGATTAGAAAGCCTGACAACTAAGTGCATACAGCAATTCTGTTAC
TGCTACCAAAATTTTTTAGTTTGATACAGTATCTTATACTCACCTAAGTGAGATATTCAA
GGTTACGCAGCGAAATATATCTAAAACTAAACGTCACAAATCGAAAATGCATCGATTCTT
TCTCTCTTTATTATATTAAGATATATAATTTTTTACAAGATACAAAAATCTAATTGGAAA
TGTAATCGAAATTAAACTGATTGTAAACATTCAATAATTTTCTCTAAATATTGTGATGCT
GCCTCCGCATTTTCTATCATGAGTTAAGAACTATCTAACGGCCAAAATATTTGGATATGT
ATTATAAATTATAAGCTTTAAAACTTTAAACACACTATCTTTTATACCGAGGTCTGACAG
TTTTTTGTTAATAAAAACAGTCACAATGTGCTATTAAAGCACCAACAAAACATTTAGTTT
CGTTGTGCTGGTGATATCGCACAAGTTAAGTGAAAAGGGATATTTTGCTTAACTTGCTAC
GATATTGCTAGTTAGATATCTTTTTGAATGGTATGTGCAAATTTTTTTTTTTTTAAATAT
GTTTTGAGTTGATGATGATCATTTCTGTTCCTAGTAGGGCATTCGATGCGGACACTTTTG
TATTTTAGGAATTCTTCGTTGCTGAACTAACTCAATAATTTTGAAAGCCTAATTCGATTA
CTATTAATTACTAACTTCTTAGGTATGTTTATTGAGTCTGTGTTAAGATTGCTAAGATGA
TTATACTTTACCCCTTTCTGTTGGTGATAATCAATGATCCTCAGAAAACATGCATCACCG
AATGAACATAGCACGTCTCAGCCATTAATTTCGTAATTATTAATGTTTTTATATTAACTA
ATTTAGATTAATTGATTTTAGCTGTTTTTTACCGAAGCATTTACTAAAGCCATTTACATG
TATGATGATACTTAATTTTCAGTTCTGCTTCTGAGAAAAGCTTGAAGACAACCTGATACC
AAGAAACTCTCTATTATCTGATTGTGTTAATAGGCTTACTGCATTTGCTTGTGTTTTGAA
ATAGATAAATCAAATATATATGTTCGTGTATTAATTTGGAGTTTGTCTTAGTATTGATTG
TTTCTTTGTTTATAGTATATATTGCAAACAATTAGTCAAGGATTTAGGCATTTCGATGTG
ATTTTTGTAAGCTGATTATATGTACAATTAGTGTTTTTGCCGCTCCTAATTAGTGATAAC
TAGTTTGAATACTCGTTAATTTTTATGACCAAAAGTCACATTAGCACCACTATTAGCTTT
ATATCTACCAGGTGAAGCGATTTTGCGTTTCGTATAAATATAATTTGAATATAGCAATCA
ATGAATAAATTCGAAGTACAGAAGAGGTTTACTGATAAGGGTAGTTAAATAGCAGAAGGT
CGTTATGGATAGTGATTTACAACAAATGAAATAGAAATCGAAGGGCTGTATTTTGTAGCT
CTGATTTATCAACATACTTTGGCTTAATTCCCTAGAGGTGGGCATATAGACAGTCTTTTA
ATTCTGTAATTTATTTGTTTTATATCTTATAAGCAATGTGCTTTCTCAATTAAGTTTCAT
CTTATGGGGTTAAAATTGAACTTCATATTTTTCACTTGCCCAAGGTCTATTGTATGCACG
ACAACAGCCTACATCGGGCTTCTTTAGAAAACAATCAAAAGGATTAGAAATGGGAGATGT
TATTCCACTGAAAGTTAATTTTGATCTAATTAATGTTGATGACGAGCCGTTTGAGCTTGA
ATTGCTACGTGATCCATATTCTCTGAAAAGTTGGTTACGATATATAAAGACCCATGAAGG
ATCTACTTTGGAAAAGCGTGTGCTTTTATTTGAAAGAGCTTGTTCAGAACTCCCGGGAAG
CTATAAAATATGGAAAAGCTATTTGGAACTACGTGTAGCGCATGTTGAACATTTGAACCC
ATATTTTCATGCCGAAGCTTTTGCTTCTGTAAACGATTGTTTTGAGCGCTCTTTGATTTT
ATTGCATAAAATGCCTGTTATTTGGAAACTATATTTACAATTTTTGATGAAACAACCAAA
TGTCACTAAGATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved