Locus fta3
snOPY snoRNA Orthological Gene Database
fta3
fta3
II
snoR47
1864..1948
3096
GTTTCTAAGCATTTTCGTAGTAACATCACCACTTTCCTGACCAGACCTTCTACTTGTTC
GAAAGGGCTCCTGAGAAGTGGAGGATAATTTTTTGTTAAGTAACGGTGACTTTGAGGTTG
TAGGATTGATTTGCAAAGGCGATGTTGCCAAACCTCTAGCAGTGGTAGGACTATTACATC
TAGTGTCACTACTTCCAACCATGCTGGAAAATTTTGCAGACCGTTTGGGAATCAACTTGC
GACTATTACTAAGTGGGCCTCCGTTGAGCGCGTTAGTGCCTGCCGATCCATAATAAGGCA
CATGATTTATAGTTGGCAGCATTTCTAAGGGAAGGTTGTATGTTTGAAAAGAGTGAATGG
ATGCTGAAGGAGAATGTAATTCATCATCATTGGTAGGGATTAGGTTTTCGTAAACAAAAT
TTTCTGATTCTTCATCGTTTGGATCCTGATCAACGGCAGAGGCCACTCTTGCTGCAAACA
TAGCTGCTTTGGAAGTCATTACTAAAATGCATGTTAATATAATGATTGAAATAGACAAAT
TGTGTCCTCAAAAGCTAGCAGCTGCTAGATGCATACCATTGGGCAAACTAATTTTTTTCT
TCTTTTGAGCATTTTTTTTTGTTTTAAGGGTTTCTAGAGACGCTTTTCTATCGCAACTGC
TCGGAATCTGCACTTGAGACACATTCAAGACCGTCTCAGTCTCAACAGACATTTGCATAG
GCTTGGGCTCCGACATATCCTCCTGATTAGCAGAATTTACGTATTTTCGAAGTTAGCTTA
TGAAAATATTTTGATTTTCGATATTTCCATTCCTATGTATATGTATTGGCATTCCACATT
GGCAAAGGATAAATAGTGCAACATACATTTGACAAACGTCAAGTTGCCAAGCCCTACCCT
AATTAAATTATTAGCTGCTAGTGCTAATAACTCCTTAAAATTTTTGACGTTAGCAAACTA
CTACGTGAAAACCAGGAGAACTTGTAGAACTCCCGGTTTCCTTTAAATAATCTCTGATTT
TGGTTTCTTCATGTAATAGTCTTTTATTAGTACTAAAGCTTTTTATCTCCGTATTCCTCG
ATTTTTAGGAAAATACTGATTAGTTCAATATTTGAAAATGCTTGTTACTTAACGAACTGA
CCGTATGGATAATAACGACCAAATATCAAACCTTTGTCTAGGGGCTTTACAACTGCTTGC
CGATCAACCTATTTCGGTTATCTCGAATGAACCATCTGAAGAACAGCGGAATGAGCACGT
CCTGAAAAAATGGGAAAATAACGTTTTAAGACATTGGAAAATTCTTTTTTCTCTTTTTAT
GCAAACTTGTGGTGATAGTGTACAAGGAAATGCTGCCTTCTCAATCCTCAATTTCATGAC
TACTAATAGTTTAGTGGGACAACTATATCAGCGACTATATGATGAGTCTAATTCATTGGG
CTTTATAAGTAGCCCTTTGAACGAGACAGAACATTTGTCGGAAGAAAATTTAAAAATCGA
AAGCAGTATTACCTTCACTAGTGAAGAAATTGAGAAGGAAAAAGAAAATATTAAATCTGT
ATTACTTCCTTCAGTGCAATCTATTTCTTCTTCTTTAGAATTGTATGCGTCTAAAGAATC
TGATTATAGAAGCTCAATTGAAGGTGTATTAGCTGACTTGAAGTTAGCGCGTGCCCGTTG
GGAAATCGTTAGAAACGTGACACAAATACTTTTGCTCGAATCCGGCATTAGTTTCCTAGA
GAACAAAAAACTTGCATATATCATGGATCTATGTGGTGATCGTGAAGACAATTATAGTTC
CTATTAAAAGTCTTTATTTTGTTTGTGAACGAAAAATTTGGTATGTTTTTATGAATGTTA
TAAGCCCAGTGATGCTTTTTTGAATTTCTTCAACGGAGCCGTTTGTCTTATTGACATGCG
ATGTGGGACGATATTTGACATACTGAGGGCCAATCATTCATTTTTCTGACTTCATAATTT
TTCTTACTAACCTTTAGAGTAAATGAATTCTTTATTATGAATATTTTTAATAAAAGCTCC
TTTTTTACTCTTTGTAAAAATTTTAGAAACTAGAATACATAAAATTTTATTTAAAGGTAC
TCTAACAACAATAACGGATGTAAAGGAGAAAATTGGCGAAACCGTAAAAATAATAGATTT
CTCTACAAAATGAAGTAGGGTTGGGCGTTATCGGTAAACTGAATCAAGCGGACAAACCAC
CGTTGTTTTTTTAAAAAAGGAAGGCTTATAATAGTCGGAGGTTTTTGGAATGAGACAATA
TAGAGGCGCTGATGTCAATTGTGAACATCATCAAAGGTATACTAATATATAGTAAATAGA
TTGTGAACAATCAAAAATTTTGCGAGCTCAGTAATTCTTTCTCCACAGTCGCAAGAAAAC
TGGCATCTGCTAATGTATAAAAAGTCAAGAGTCAATAGTATATACAAATCAGTTATAATT
TAAAAACCGTATGGACAACAGACACTTAATTATTTTGCTTTTTAGAAGTAGTCACTTCTT
TTGAACGACCGTCAAAAGCACCACGGTTACCTTTGCGAAAATTCCTTTTCATTCCATTAT
AATTATCGTTGGACTTCTTATCTCCCGATTTGTTGAATTTACCGGAAAAAAGACGGCGTC
GTTCTTCTATGTTCAGCGTGGCATTGTTAATTTGCAAAGTTTTTTTGTTCAAAGCCAATT
GCACGCATTCATGGTTGACAAAATCAACATATGCGGTGCCTTTGCGACGAGCAAACTCAA
TAGCCTTGACTGGTCCAAAAATGCTCATAGCAGATTTCAATGACACATCAGATGTTTCGG
GAGGAATGTTCTTGACGAATACAGATGTCTCCAACAGTTCATTACTCTGAGTGTACGGCG
CTGTTGGCTGCTGAGTTTGGTCAGCATTAACACCTTTAACTGTTTGACCAGTTGTAGACG
CAGTAGAACTAACTGATGCTTGGGATTTCACATCAGGATGATTACGAGCTATGAGATCAG
CCCAAGATTTAGGTGCTGTAGCAACATTTGCATCGCTAGCCCCTATAGCATCAGCATTCT
TCGAGTTTGAAGTCAGAGCTTCATCTTGAAGCTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1839, 1997..2096
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved