Locus Mono:sno16
snOPY snoRNA Orthological Gene Database
Mono:sno16
Mono:sno16
II
snR100
1001..1188
2187
GAGTTGCGAAGAGCCAACAAAACACCACGAGAAGACCAAGAAAACTTGTATCCTAAAGG
ATTGTTGGAGTCCTCGGGAGCGGGAAGACCTCCACAATAAGACAAGAAAGACTTAATCTT
ACCGCCAGCTTTATGAACCTCTTCAATGGTCTTGATAGCATATAAATGATCAATACCGGG
ATCGACGCCGATTTCGTTCATACAAATAGAACCAGCCTTGATGGCAGCTTCCTCCAACTC
AGCCATTTTGGGATTCACATAACTGGTGGTACAAACGTGTTTACCATGCTTAATGGCAGC
TTTCATAACTGTTGCATGATAAGTGTAAGGAATCAAGCTGATGGTAAGATCATGTTCGGA
AACAGCTTTCTCAAGAGCTGCTTCATCATTGACATCCAAAGCAATGGCTTTGCTGTTTGG
GATACCATTAATAAATGCTTCAGCCTTAGAAAGAGTTCTGCATGCTACGGTTATATTATT
TTCTTTACGACGAGATAAATATTCTAAAGTAGGATGAGCGACAAATCCCGAACCAAGTAA
TAAGATGGAAGGCATTTTGATGTTGAAAATGAAAGAGGCAGTCAGTTAAGGACAAGTGGT
AAACCAAAGACTTCTGTTTTGTCGTCACGGTTTTAGCGATATATAAGGGGTTCCTTTTTA
TCCACAGATTTATTTCTGATGGCCGAAATCGTCGTCTAAATTGATGAAAACTGATTATCT
CGAATCGGTTAAAAAAGCAGTCACATGGACCATTTTTTGAATTAATATTTAATCGTTACG
TTTCCTCTCAATGTTATGTTTGGCTTACTAGGGGAATTCGTTATTATCGACAAGTTTAGT
CGATAATTTGTTAGCAGCGATGTCGCAACTGATAGTTTTAGCAACTTTTTTTACGTAGTT
TTTTTCTGCAGAACAGAAGTTGCTTAAAAGCTAGTAGATGCCATTCGTTGTTGTTTGGGG
GTAGATTAAAGAATTCTAAGCTTTAGTATAAGAATAATTTGTTTCTCCTCTTTCTGCCTA
TCTGTTGTTCATAATCAACTGCGTAGTTCTGGTGAAGGAGTAAATTAAACTGCCTCGCAC
CGCCGTACTCATTTTTACCTCGAGTATGGTGGCCGTGGAATGGTGGTTTTTTATGCAGTC
GGGAATGAAAGCAGCTGTAATTTCCTTGCATAATGAGCCTAAATACCTTTTTACATAGAA
GTTAAAATTTATGAGATTTTAAATTAAAAAATCATCAAAAGTGCAAATTTTCAAGTACAT
ATACGAATAAATTTAATTATAAAGTAAACCTAAACGTTGTTTAAAGCTAATTGCTTCTTG
GTAACCGATTGCAACATGCCATCATTTATTTACATTGACAACCCGTAAATATCCATAATA
GGTAGAATGTTATCGACAATGAATTTCAAATGCATATATATGTTTAAGTAAAACAAAATA
CTCTACACTAGCAGTCCCGCAATGGGAAAATAAAGAGGCAGCAAATATGAAAAGCTTCCG
TCATTTCTTTTTCGGTCTTGCTAAAAAAATAAAACCACACATAGCTTAAAAAAAGTAACA
ATGACTAGACATAGCATGTCATGAAAATCAACTGTTTCTTTAAGCTTTTGTAGATAAACC
GAAAATTGACAAATTGAAAGTTCCACCTAAAAATGCATCACTGTTGGATCCTCCCAAATA
ATTTAATAGAAATTATTTAAATTGCATGTTCTAAATCAACAGGTATTAAAAGATATTACT
GGGGTTGTTGCGAATAGCGAGAAAGAGGGTTTTGTTGCTGGGAAAACTGCTGATGCATTG
GGTTTCCCTGACGCCCTTGCTGAGTTTGATACATCATAGCGTTTGGCTGTGAATAAAGTC
TCTGTTGCTGATCGAATTGCCGAGGAGATCCAGGTCTTCTTGACATACCATATGCAGAAG
GATCAAACATTTGAGACTGTTGCATATTAGGTCGCATATTACCTTGAAATTGGGGCATTT
GATATCCCATAGGGGATGACTGCAATCGGAAAGCTGAGGATCCAGATTCGAGATGCGTAG
GTGGATAACGGTATAAATGCTCAGCCATGTACGGTGCTACCATGACCGGTCTTTGCATAT
TCATCTGGTTAACATTTCCGGAGTTATCTGACATTTGTAGTTGTGGATATTCAGAGCCCA
GACGCTGCTGTTTATACATAGATTGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved