Locus Mono:snR93
snOPY snoRNA Orthological Gene Database
Mono:snR93
Mono:snR93
II
snR93
1001..1144
2143
ACGAAACGAAAAAAAAAAAAAAAAAAAACTATGATTGTGGTTTTAAGAATCTACCAATA
TTTTTAAAATCAATGCATCGAGCTTTCATTTTTCCGCGCCGAGCATCAAACAAATTGAAG
TACTAGTCATAAACATAGATCATGTTTTGCGTTATCCTGTAATTGCTACGATAGCTTGTT
AGTTGTTTTAATTTATAACTTGGAATACAACATAAATTACAGAGTAAGCGTTTATTTGAT
CATTTTTTTATTTATTACCATTTTATTTTATTAACATTCCAGTACTTCACTTTCCTTCAT
CGTTATGTTTTACACAAAAGTGCTCAAAAACATTTCAACTACACGATTATTTAGCAATTA
TGCATACACACAGCACCAATGCAATGGGAACTCGCCGAAGTTATCATTCATAATTTAATG
TAATACCGACGATATCGGTATTCGCTTTAGTAAACTACGCTACAGAAACTTGTAAACGTG
ACTGCTTTTTTTGAAACAATATTTTGCTTTGCATAATCCTCTTTCACCTATCCAGGAACC
AAAATGGCCAAGTCGAAGAATCATACTAATGTGAGTTTGTCTTTGTAGATTGTTGAATGA
ATGTTAATACTAACTGAGCTTAGCACAACCAAAACAAGAAGGCTCACCGTAACGGTATTA
AGCGTCCTCAAAAGCACCGTTACGATTCTCTTAAGTACCGTGATGCTAAGTTCCGCCGCA
ACCAAAAGTTTGCCAACCGTGGTACCGTCGAAGCTATTCGTCAAGCTAAGGCCTCTGCTT
AAAATGCTTGGAATTAGTTGTCTTAGTTTGGTTTCTACATAAATGGCATAATTCAACGTT
TTAAAAATTTTGGATTTCTAAAATGAGAATCTCGTTTGATTTGTGCTTCTAAAAATAAAG
GTAGTCTGCCGGTTAAATTTAAAGCGAATGCGTAGAGTAAGCTCTTACTGGATGTATATG
AATAGCTGTGACGTTCTGTTAATCTAAAGTAAATTGTATCATTGCACTTTTTAACAAAAT
TACCCGTGAGATTAATTGCGGTTGAACTTGTTTTTCGTGCTAGACTGATGATTCGCCCTT
ATACATATTGGCTAACTTTCGGCTAATCTTCACCGAATTTAGTCAAGAATTGGGTGGTAC
AAATTTTCTATTAATTGATAGTACCTTAGCAGCAGTATAAATCTGAATTTCTTAATATTA
TTATTGTGTTCATAGACTTGTTAGTGAGTACTCTGCTAACTCGCCGGTAAATAGCTGTAA
TGATAATAAGCACCTTACTCTCTCTTACGATTAAACGGTGGCTTTATATTATCAAATCCC
AAGGAATGCCGAAACATTGTATAAGCCTACTGTATATAAACGTGTGAACTACCATAAAAT
AGCATCACTGAAAAGGAAATTTGATTGCATAGTAGTATAAACAATAACTAAATAGGCAAA
TTATTTTCCAACGTGAGACCAGTATACATAATTGAAATGAAAGACCTTTAAACAAAATTG
TCAATGGTCATTATAAAGGATTCCACCGATAGCAAACAGAAGCTTGCAGCGGAAAATGCC
ATCATCAACGTTAAGCACTCTCTCGAAGATAAGAAGTATAAAGTAGTTCAAACAACTATT
GCTCGGTAAAAACATCCGTCTTTTAAGCGTCAGATTTTGTTAAAAAAGGGAATTTAGATG
ATGAAAAATAAAAGGCAATAGTCTATATACATCTAACAATTGACGGAAAAGAAAGAAAAT
GAATAATGAAATGGTAGTGCAAAAAATAATTTCTTAAAAGAACATTCAGTTATTTCATGA
ACAATTAATCATCGACCATTGAGAAATGACGAAAAGAAATCCGTTCAAACAGCTACATAA
AGCGGTATTATCGTCGAATTGTTGCTTGTGGAAAATGAAACCAACAAAAAAGAATGGGAG
AAATTGGATTGAGCTTAAATTACTTTGAATTTCCTGTCTTATTCTTCCGAGGTGGAGTCA
TGTGCCAATTTTGACTTGAACCTTGGTATCCGTAGCGTTGTTTTTTTTCAGCCGGTTTCA
AAATCTGGAAACTGCACAACAAGCTCTCGTCAACACTCATCATCGCACCTGCATTATCAA
ACTCGCCACAGTAATTAGGTGCACTGAACAATGTGACTAGCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved