Locus ero11
snOPY snoRNA Orthological Gene Database
ero11
ero11
II
snoU18
2930..3016
4123
ATCCTAGTACTACTGTCACCCCCAAATCCAGGGATGCCGTTATGGATGTTGTACAGAAA
TATTATCCTCCTGAATTTTTGAACAGAATTGACGACCAAATTGTTTTCAACAAATTATCG
GAAAAGAACCTTGAAGACATAGTAAACGTTCGTTTGGACGAAGTTCAACAACGTCTTAAT
GACCGTCGTATAATCCTTACAGTTACAGAAGCAGCTCGCAAATGGCTTGCTGAAAAAGGT
TATTCTCCAGCGTATGGCGCTAGACCTTTGAATCGCTTAATACAGAAGCGTATTTTGAAC
ACAATGGCGATGAAAATTATTCAGGGAGAAATTAAGTCGGACGAAAATGTTGTGATCGAC
GTTTTGGATGGTGAACTTGAGTTTAAAGCAAATAAGCTTGAGCCACAATCTACAAGTCAT
GAGGATTAATGTTATTATGAAAACCTTCTATCTGATAATTTCTTTATTATCTTAGTGATG
ACCATATTGAATAGCGGCTTTAAATATTTTACGCAATTATTTATTATCATTTTTATTTAT
TCAAACACCGATTACACAAATCTCTTATGTGCAATTGTCTGAAATTGTAGTGGTTAAGAA
GCAAGTTATGCGTAATTACTAGTAAACTGCTTATTTTTCTTTCAAAAACTCTCTTCGATA
TATAATAGTGGAGTTAGCTAACATGTTTGATAATAATTTTTCGATGCTTGTAAATGTAAC
ATCAAAGAATCGTTCCAATTGATGATGAATTTTCTACCTGGTTTATGTTCAGTGTTTACG
ACCGGAATTTACAGCTCTCAAACTCAAATATCTAATTCAGGTATAATAATAAATTCAGCA
CATGTGTGATAAAAATTTGCTTTTGCTTTAGAAATACTAGTTTAGCAGAGCGCCTTAAAA
TATATTGCATATGCCGGTGGCGATGTATATTTTTCAAGAATATTTTCAACTATTATTCGT
ATTGCACAAATTCTAAAATATATAGCGTTGATAAGCATAAGGAAGTATTGACGAGTTTCC
GTGCTTAATTTTCTAGAAAAACATAAAAAGCTTTAAAGTAAAACATACTCTATTGCATTA
GCTAAGCACAATTTAAGGATATGAGGTCGCAGTATATTTATCAATTCCTTCTTTGTCCTT
CTCCAATACTCGCGGTAGTACGAGTACTACACAAATCCTTAGAATTCAATACAAAATCGT
TAAAAAAATAAAATATAACCAGAATTTCTTTTAAAAAATAATTTAGTGACAGAGAAAAAT
ATTGCAATGATTGGAATTACAAAGCTCATTTCTATTTGGAATGCCATTTGGAATTTTTTG
TTGCTTCCGGAGATAATAATCTCTCAAACAGACACTAGTTCTACAGGCATTTATCAAATG
CAATCCAAAGTTCGCTCATTAGTACCTGTCTTAACTGAGCGTAGTGATTACTTTTCATAC
TACAGAGTAAATCTCTATAGATCAAGCTGCCCTTTATGGGAAAATGACAACGCAATGTGT
AGTAACCAAGGTTGCGCAGTTAAATCATTGAATGAGATTGAAATACCCAAAGTATGGAAA
AAGCTCAGTGATTTTGAACCCCATTCTAAGAAAAATGATACAAAATGCAATTGGAAATAT
AATCCTGACTTGGATTACTGCTACCTTGATAATTCCACTTCTCCCGATGAATACGTGTAT
GTATCCCTTGTGCAAAACCCAGAAAGATTTACTGGATATGCTGGTGATCATTCAGCTGCG
ATTTGGCGAAGCATTTACGAGCAAAACTGTTTTGTGGTTGACGACGACGATAATCCATCT
GAACAACCTAAAAGTAATGCTCTTTTTAGACCAAATCAAATACCTTTGAACTTGTTCACG
GAGAACCATGATGACACTTCTTTATCTCCATCTGTTGCTTGCCTAGAAAAGCGTATGTTT
AACAGAATAATTTCAGGATTTCATGCTAGCATATCAACTCATGTTTGTCAAAATTATTAT
GATGTCGAAGAGCAACGTTGGACCCAAAATTTGGATTGGTGGCGCGCCAAGGTTGGCAGT
TTTCCCGATCGCATTGAAAATATTTTTTTCAATTACGCGTTGTTACATCAAGCGCTTGTT
CAAATTGCAACCCAAATGAAAAACATTACTAGCGACAGTTCTTTTACCTTTTGTCCTACT
GATAAAGATGTTGATTGGCGTACTCACACAGCATTTGAACAGTTGGTTTATCACGCTTAC
CAGGATCGTCATGTTATAAATCGCGAGCAGTTCTTTGCCGATGAAGAGGCTAAGAGATTT
AAGGATAGCTTTCGCAAACATTTCCGTGATATTTCTCGCATAATGGATTGTGTTGGCTGC
GACAAATGTAGACTTTGGGGAAAAGTTCAAATCACAGGTTATGGCACGGCCCTTAAATTA
CTTTTGGAGCCTGAAACTCAATTAAGTGACTTAAGACCAGAAGAAGTTGTGGCTCTCGTA
AATACCTTTGACAGAATTTCACACTCTGTCGAAGCGACATTTTGGTTTAGTTTAAAGGCA
AAAACAAATGACACCTTGGATGCTATTAAAGCACTCATTTACAAGACATATAGGTCTCCG
TCCAAAGAAATCCTTGCGTTCTTTATCGACCAGACTTGGTATCTATTTTATGCTTTGTTC
TTTATATGTAATGTCCCAAGAGTAATCTAATTTTTATATCCTATTTTTTTATTTTTCCAT
TCTTTTCTGGTACATGATCTCGACCTTAAAATTTTTTACTATAAAAAGCTGGTGCTACTA
CGATGAAGTTGGCCTTTCCTTATATCGAAAAGCGTTATCTCTCTACTGAAGATGCCGCAT
TTTTGGAAGTAAGATTATTTGTCATATACATTTTTAAAGCGAGGCATAAAAATCATAGAG
AGTCCTCATTTTACTTATAGTGATAGGTATGTCAAAAAACGGTTTTTGGAAGCTATGATG
ACCAAAATTGGTCCGTGTTACTGAGCGGGATTAAGACCCCAGCAAACGAAGAGAAACCCA
ATTTTTAATTCTGATTTTTTCCTCAAAAATTTTTTTGCTTCAAATTTTGTTCCTTAATTT
ACTAACATCTTAGACGATAAAGCTCAAGTAGTGCTACAATTTGAAAATTAATGAATTTGT
TTACAATATCTTTAATCGTCATTTGTATTGTATGTCCATTTATTCAACGAAATTTAGTTT
GTATATGTAAATCGGTATAGAAAGTAAGAATCAGTTAAGTCTATTACAAGACATTGGGAC
GCCGTGTAAATGTTTTATCTTAATGACATGTAAGTTGATATACCCATTCTATAGGAGTTT
GCTATTTCTTCGGTTTTCCGCTAACTAGTAAAAAAATAATAAGTCATAGAACGTTTTCAA
CAACGTAGTAGCCAGAAACCATGCTGTTTTAGTAACATAATATAAGCTTGGTATGGTCAA
CTTACTCCTACCAAATTTCCCAATTGAGTACAACAGATATTGAAACAGTATTCATTAGCG
AAGCTCTTGAGCAGTTCTGTTTTTTTTTTTTATATATTTTAGACAATGTCTGATATCGAT
GATGAGGAATTTGAGCAGCTTGCAGTTAGCGCCTTAGAAGAAGTAGAGAAAAAAGCTGGT
TTTGCTCAACAGCCAACTCCTCAAAAAGTGTCTAGGGTTACAGCTCACTCTATTTTGGTA
AACCCTCGACAGGTAAGAAGCTGAAGACAGATCGCATGGTTTGTTATAGCAGGTTGAAAA
TGCATTTTTAATCTTGCTTTTTTCTTTTCTGTAGTGGGATTATCACCATTCTGATAAGGA
CTATATTAACTTCTTATAGAAAGGAAATCCTTTATTGGTAAGTTTCTTACTCGTGGATAA
AGCTTGCTCATAAACAATAGCCTCACGTTCGAAATGTACCATGGGAATACACCGACATAG
TTCCCGATTTTGTTATGGGAACAGGTATTTGCTCTTTGTTCTTAAGGTATGTTAAATTCC
CCAAAGCATAATTCGTTTATTGAAGGACTGACTTACATCATGCTAGCTTGAAATACCATC
ACTTGCATCCTGAATACATTTATTCACGGATATCTAAACTCGGGAAATCATACAATTTAA
GAATCTTACTGATTTTAGTTGATGTTGAGAATCACCAGGCTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2905, 3073..3123
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved