Locus Mono:snR33
snOPY snoRNA Orthological Gene Database
Mono:snR33
Mono:snR33
II
snR33
1001..1146
2145
TCCGTTTCACGGTTGGAACGCCGTAATGAAATTATCGACGGACTTGCCGAAATCGGAGA
AAAAGTGCAAGAAACTTTACATCTTAACGCCGCCATAAAACAAACTGCCATTGAGCAGTT
AATTAACAAGGACAAAATGTTAATTATTGGACGAGGTTATCATTATGCCACTGCCTTGGA
AGGTGCATTAAAGGTTAAAGAAATTTCTTATACACATGCTGAAGGTGTCTTAGCCGGCGA
ACTAAAGCATGGTGTGTTAGCACTTGTCGATAATGATATGCCAATAGTTATGCTTTTACC
AGACGACTACAACTTTCCGAAGGCTTGGAACGCATTTGAACAAGTTAGAGCACGTGGTGG
TAAACCCATAATTATTACAGATAAAAAACTAGACAATTTAGAAGGCTTTACCATAATTAA
AGTTCCTAAAACTGTGGATTGTTTGCAAGGAATTTTGAATGTCATTCCTTTTCAACTTCT
AAGCTATTGGTTAGCTGTTAAACGTGGCCACAATGTTGATCAGCCACGCAATTTGGCTAA
ATCAGTTACGGTGGAATAAATTTGATTATCCCTCATTGTTTATTATTATGTGGTTTTTAC
GCTTCACGTCGCTTGTCATGTTTTTGGCATCCTTTAAGGGGCACAAGCCAATCTTTTTGT
CGTTCATTAAATTAATAGAAAAGGATGGGTTGCCGGTTCACGAGGATGTACATGTGTTTA
TTTCATGGAAGATATTCTTTTTATATGCATTTTTAATTTAATCTGATTTAGTTTGCAATG
AAGGCATAGTTGCTTAGTTTTGCAGTGTATCAGATTTTTTGTTTTGGTTTAATGTTATCT
CTTGGAAACTAATGATGGTCATTTAACGAAAACAATGCTGCATAATTGGGAGTTCTCATA
TTGAATATCAATTCATGATTATGCTCTTTTAAGTTGATTTTGAATGTGGAAGTTTTGTAA
CTATATCGTAATAATTTCTGTGCTTCTATTAAATTACGTTTCTGCAACTGCAAATGGAAT
ATTTGAAAACTTATTCTAATATTCCTATATTGCTACTTCATCATGAAGTTGTTGCTATAA
AAATTACTCTAGTTTGAGGGAGGGAACCCAAATCGTGGTTTCTTCCTATAGAATGAGTGT
ACAATTACAATAGTGATGTACTAAACGTAATTTCCTACAAAAAAATGAGTAAGTTCTCTT
CTTTTACTTTGTTATTTTATTACCCGTTACAAAGATATTAGGGTTGATTCTATTTCAATT
CCTGTCCGAACTGAAGGTAATGGATATCGAAAATCACTAAATGAAAAAAAGGAGAATATA
GATACTTAAATTTCATAGCGAAAATAATATATTTCTACCTCAAAAAAAAAACATGTACTA
AAAATTCTCCCCACACCACTTTCAAACATAATCAACGTTTCTAAAAAGACAAGGCGTCAC
TGTTTACTTCTGTTCAATGACCTCAACCCAGTAATTATCAGGGTCCAGTAAGAAAGCAAT
ATCCTTCATTCTGCCATCGGTCAATTTCTTCTTGAATGGTAGCCCCTCAGCTTCAAATTT
AGAGCAAGCTGCATTAATATTGTCAACGGAAATACAAACATGACCATAACCCTTTTCATC
GCCGTCATTGCCATTATGGTAAACGGGTCCTGACTCCTTTTCAGTACCCCAGTTATGAGT
CAATTCAAGTAATCCCTCACGATCATGTCTGGGCAAGTCGCTAGGATAGGCCAAGAAATA
ATTGGTGAACTTACCATTGGGATGATCCGCTTTGTCAATTACCTTCATTCCAAGTTTCTC
ATAAAAGGCGATACTAGGTTCGGGATCCTTAACACGGACCATTGTATGATTAAAACGAAA
GTTAGAAATATTAGCTTTGGGCTTAGTTTCAGATTGAGAAACAAGCTCAATCCAGTAATT
GTCAGGATCCAAGGCAAAAGCGATGTGTTTCATCTTACCATCGGAAAGCTTTTTCTTAAA
AGAAACCCCCTTGGATTCCAAATATGCGCAAGCAGATTCAATGTTATCAACAGTAAAGCA
GATGTGTCCAAATCCTCTCTTAGGCTCGGTATTACCATTGATATAAACAGGGCCTTCCTT
CTTCTCAGTGCCAAAGTTATAAGTCAGTTCCAATATACCTTCACGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved