Locus Mono:sno20
snOPY snoRNA Orthological Gene Database
Mono:sno20
Mono:sno20
II
snR35
1001..1173
2172
GGAGTAGAGATGTGTACGCGCAAAACTGCGTTAAACAGTTAGACTATTTGTGATATAAC
GAGAAACTGTTAAATGCGTTATTCGTCTTTTGCTATGCTTGTATCGATGGAATTTGTGGA
AATACATTTTTTGTTTTAGTTTATTTTATTGAAATTCAAAAAAATTTATATGAGGCTAAT
ATAAAATCGTTTACTGTTTTTTTGTAAAATCACTATTGATATAACTCAATCGACCACCTA
AAATTCGACCTCCATTAACATGAAAATTCAGGAGTAAATTTTGAAGTAAAGAACAGTTTA
GTCAGTAAGACTTCCGAACACTAATTCCTTAAGCAATATATCAATATATGTGTCCCGCTA
ATTCTTGTTTTATTGCATGTTTAAAGAGATTGAGCACTAAGCAACGTAAGTTTTTGATAA
ATCTGGGTTTCATGAGCCAAAAAAAATAAACATTTTTTGGTTTTTTTTATTTTTTTTTTG
GCTTGGATATCTATTTTTTGTTTAAATCGATTATCTACTAAATTTATGTATTCATTTTAA
TGGAGAAGCAAAATTACTATTTACAATTTTTTATTATTAACTAACAATATGATCGCCTGC
ACCTTTATCAATTCATATCATAAAAATATGTACTTACTTGTGAAAAAATGCCTGCTTATT
TTTTTTATTTTCTATCCAGTATAATGCTCAATTCTGCTCAGTTATTGATGTAGACAATAT
ATATAATATATACGTATAGAATAATTAATTGTTGTATAACAATGAAGGGTCAACTTAAAA
AATGAAAGGACTAAATTTCTACAGAAATCGATTAAAAAAGTGTTATTTTATTTTCATTTA
TTTATTTTGAACAGCACTTGTTTTATACTTTCCTTGACATTATCGTAACCTCAATAGGAT
AATAACCTGAAAATGCAGCAAACAAATTACTTAAAAGGGTAGGGTTTAAAAAACAGTCAC
AAAGGTCTATAAACGTGAGTTTGTTAAGTTGAAGTTTCCCTATCGTGCGGTTATATACCG
ACGCCCACAATTCGTGTTGCTCACTTTTCTTTTTCTTTTTCCATGGAATGGTTTGAGCGT
CATACGTGGGCCAGAGCCATATTGGACATCTTAGTGCCCTTACAGGAATAGTCATATTGA
TACTTTTTCTGTGGGTCGGTAGTTCAGATAGCTTTTTGCTTTGTAGTATAAGTTTTAAAT
TTTTTGTATGACTCATTAATGTTTTTTAATTCATTTTAATATTATTCATGTTATGTGTTG
GTTGTATTTGTCTGTCTTGTGTAAATTTTGGTTGTATTCGTGGGTTTTAAAAACCTGCTG
TTTACTTAATTTTGAATTATCGAAATTTCTTCCATTTTTTAGTGTTATAGGGACAGCTTG
TTTGTCGGACAGGATACTCAATGGGTTTAACAAGCTACGTTCATTTCTATTTTGTCACTA
TTATGGCTGTAATGTGAAATATCATAGTTGATTGTGCCGTGGATAAAAGAAAAAATCCTA
GTGTTCTTTGCTCTGTCTTCTCCACGGGTATTAACAATGCACATGCTGTATGTCGTTTAA
CGTTTAGATGCATTTCATATTTGTTCACCTTATCGTTATCTCTGTTGTATCTATTAAGTT
CCCACACTGGGGCACTAAAATGGTGCGGAAGGATCCTATAATCGTAGGAGTCGTTGGTGT
TTCTCTGCAATATCCGAGGATCTTATCTTATAAAAGGAGGTATACGGCACATTGCAAAAG
AAAGTCAATTATCAAAATTGTATTGTAATTTTGTTTCCAGACAATTTTACCCTTGTTTAT
TTTGTTACGGTAAGTATTAAAAAATATGATGTCGGGAATGAAGAAACGATGAGAGCGATT
AAGTGACATACAAACGATTTATTAGATTGGAATTGAAATTTACGTTCGTTTGGCGTAAAT
TCTATGATCGTGCTACCAAATATGTAGAAATAGACTTTGGTATTAAAGGAGGATTGACAA
TAAGCGAGTCGAGCAGTAAGTAATTATATTCTTGGGCAAAAATTTTTTTGTCATAAGACA
TGCACTGCCGATTTCATTTTTCTTAGGCAAAGTAGAAAAGCTCCGCAGCAATCTTAGAAA
GAAAGGCAGTTTGTAAATAGAATCAAACAATCGTTACCACCGATGAGACCAAGTATTTTT
GGCTTGGACGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved