Locus Mono:snR5
snOPY snoRNA Orthological Gene Database
Mono:snR5
Mono:snR5
II
snR5
1001..1143
2142
CATGATTTTCGTTAAGTAGAAGAACTACAAGTACGCAGGAAACAAAAAAATATAGAGTA
GTCTTTTCTTTGAAAAAGTCGTCTGACAATAAATTGGCCTGTACGAAAGGTTAGGAGTAA
AAAACAAATCCCGTTCTAAAATCCTGCTACTTAGAAGAAGTAAAAATCAAGTAACAAGGT
TGCTACATTTGATGACGTAGTATGGACTGGTACACAGGGTGAGGATAGAATGAGAATTAG
CATAACGTTCTAAAATTTATTATAATTTTTTTTTTTTTTTATTTTTGTTGTTATTTATTT
ATTTTTAATTGGATTTGTTGACTTACAAGCCTATTTATGCGTTGTAATATTATCATTATT
ATTATATGGTATTTTTTTTTATTTGAACGATTCATCCACGTTAATAAATAAGTTATAACT
ACTAAAAAAAAAAAAAATTATATATATATATATATATCTACATGGAATGCTTGTTTGTGT
CATGGGTACTTTACTATTCAAAGTACCTGAGCTTAGTACTTACCTATTTAATTATGATTT
TTTGCGTATGAAAAGCATCTAACGCTTCTTTCTGCAAACACGATTTTTTTGGACTGCTGA
GTTAAAACCTCATAACCGCATTTTTTAACGCAAACAGTGAACGATTAGGGACGAATTATC
AACTGTTTTTAAGCAGATGTCAGTTTCAATACAACTAGCTACAAATTCTAGCAACAGTAC
GGTTGGACAAATAAAATATATTCAATAAAACATATGTGATAGTACAATTACGCATTCTGT
TTTGTTCCTCCACTCCAAAGCGAAAATTAATTCCTCAAACATTTTTTTTATTAACCGAAT
CCATTCTGCAGATATTTGTAGTCAAACAAGCAACTAAATGTTCTATCAAACCACCTACTA
ATTAATGAAGATACAAACGATTGATCAAATTAAAAAGCATGAATGTCTCAAATCTAAGAA
TATTGATATTATCAAAAAATCACGACTAGCCTAAAAAATATAATGTACACCACAAGCGAA
CCGAATTTACTATCAAAACCAGTAAACAAGGATTGTAAAAGGTGTTTGTTCTAGGTCTCA
AGCCATTTAATTACAACCTCATTGCTTTAAGCCAGACTGCAATTGGTAAAAGAGACCATT
GGCAAAGAAAAATTAATTCCTTCAAGTAAATATATACCGAGAAGCAGAGAGCAGTCACAT
ACGTTGAACAGTTGAATTCGTTATATTACATAAAGAGTAGCACAGTATTCAATCGTTCCA
TGGTATAAACAATAAATACACCAAGGATAAAAAATAAGAAATCAGCGTTACTTAAAAGTA
TTTAATTGTAGTGTACCCATATGGAATCGGACGTTTGTGCATCATTAATTTTACCATAAC
CGCGGAGTTTATACTTAAAGTCGTATAATAAAGTGAGTATGGTAAGTGACGACGCATTGA
ACAGCAAAGTGTCTCTATTCTATAAGCTGAACATTCAATTCAATTTATACGGCTACGTAC
TATATTCCTTCACGAGATAACGCTTCTAATTAACGTAATTATAAAGCAAGTAAGGTTCTA
TTGTTTTCAAGCAACTCTAAAATTTAGACAATTTGGATGCAAAATTGTCGTTCTTTTCCT
GACATAATCCAATTCATCTTTACAACACTCCCTTCGTGCTTGGGACTTCAGAACTTCCAG
TAAGACTAGTAGCCGCGCGCATGGCAACAGCCAGAGATTTAAAAGCGCTTTCAGCACGAT
GATGGTCATTACTACCATATAAGCAGGTAACATGCAAAGTAATTCCAGCTGCTACCGAAA
AGGAATATAGTAAGTGAGGGATCATTTCACAGGACAATTCCCCAACCTTTTCACGCTTTA
ATCCCAAATCGATAACAGCATAGGGCCGTCCCGACAAGTCAACTACGCTTCTAGAAAGAG
CTTCGTCAAGTGGACAATAAGCATGTCCAAATCTTTTAACGCCGGCAAAGTTACCCATAG
CCTGCTTGAATGCAATACCAAGTGCAATAGCAGTATCTTCTGCAGTGTGATGATCATCGA
TGATTAAATCACCTCTTGAGTAAAGTCGTAAGCTCCAGCCTGCATGTTTAGCCAGTGCAT
GATACATGTGATCCAAGAATCCAATTCCCGTGTCTACTTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved