Locus Mono:snR92
snOPY snoRNA Orthological Gene Database
Mono:snR92
Mono:snR92
II
snR92
1001..1145
2144
AAGGCAAAAAACTTCAGAAGCGTGAAAAACACATCCCATTCCAAGCGCATACACTCAAA
AGTAATACAAAAATGTCAAAAGATTCGGACTACAAAAGGGCTGAAAAGCATTTATCTTCA
ATTGATAACAAATGGTCGTCTCTTGTCAAAAAAGTTGGACCTTGTACACTTACTCCACAT
CCAGAGCACGCACCCTACGAAGGAATTATTCGAGCTATAACATCACAGAAGCTTTCAGAC
GCTGCCACAAATTCAATTATCAATAAATTTTGTACACAGTGCTCAGACAATGACGAGTTT
CCTACTCCTAAGCAAATTATGGAAACAGACGTTGAAACTTTGCATGAATGTGGCTTTTCA
AAATTAAAGTCTCAAGAGATACACATTGTTGCAGAGGCTGCATTAAACAAGCAAATACCT
TCTAAATCGGAAATTGAGAAGATGTCGGAAGAAGAACTCATGGAGTCACTAAGTAAGATA
AAAGGAGTAAAACGATGGACCATAGAAATGTACTCTATCTTTACACTCGGACGACTGGAC
ATAATGCCTGCGGATGACTCTACTCTGAAGAATGAAGCAAAAGAATTCTTTGGATTATCT
AGCAAACCGCAAACTGAAGAAGTTGAAAAACTAACTAAACCTTGTAAACCATACAGAACA
ATAGCTGCTTGGTATTTATGGCAAATTCCGAAACTCCATCGTAAAGGCCAGTAAAAGTCG
TTCAAATATCTAATGGTTCCCGCTTTTGTTTATGAACATATAATAAGCCATACTTTATCT
AGTACACATGCCAAACATAAAGTTACTGATTAATTTTTCTAATCTTTCTTAATATTTATC
ACTAACTAATACAAATCAATTAGTAGATGTGTATACGTACGATCGAAAACCCGCAATTTC
ATTGTAAACATAGCACCGGTCTAGTTACCGCGAACAACAAGAGCTGCGTTGACTGCTTTT
TTTTTGCTATATAATCCAGATGCAGATTATTTTAAAATACTAATCCAAATATTTTGCCTG
CCAGCACTCCATAATTTAGTTTACGAGTGGTGGTATACTGTAATACTTGGTATACAAAGA
GTCGACTCCACCCTGGATTAACTTTTCCTTATGTATATTCAGGACTAAATCAACGACTGA
CAAACAACCCATTAATCGATATAGAATTTTTAACGAATAGTAAAGGATAGAATTAATTTT
GAAAAGAACGTTTATCTACAATCTAAATATGTAATATATAATAACCAACAATCAATTAAG
TACAAACAATTTGACTAAACTTATAATCATATTCATTAATACATATGTAAAATCATCTAC
TTGAAAAGCTTTTGTAAACTCATTTCTCCAGAATCGCCCTTGTTTAATACTTTAGCAACA
GCTAATTCAAAATCTTCTTGAGTAACATGAACACGTCTTTCTCTCAATGCAAACATACCG
GCTTCAGTACAAACACCTTTTAGCTCGGCACCACTAGCACCGTTCATTTTCTCCGCTATA
CTCTTCAAATCAATGCCACGTGTTAAATTCATGGACCTCGAATGGATTCTCAAAATTTCG
GCACGTGCCTCAGCAGATGGAGGTGGGAATTCAATTTTACGATCAATACGACCTGGACGA
AGAAGAGCAGGATCCAAGATGTCGATACGGTTAGTGGCCATAATGACCTTGATATTTTTG
GTTGCTTCAAATCCATCAAGCTGATTCAACAGCTCTAACATGGTCCTCTGAACTTCGCTA
TCGCCACTTCCACCACTAGAATCAGATCGTGAAGAGCCGATGGAGTCGATCTCATCCATG
AAAATAATAGAAGGAGCATGCTCACGAGCCATAACAAATAGTTCACGAACCATACGACTA
CCTTCGCCAATATACTTTTGAACAAGTTCTGATCCACTGACACGGATGAATTTGCAATCG
GTATGGTGGGCAACTGCTCTAGCTAACAAGGTTTTACCGGTTCCCGGGGGACCATAAAGA
AGAATACCTTTAGGCTGAGGAATACCTAAGCTTTCAAAAAGTTCTGGATGCTTCACTGGT
AATTCGATAACTTCTTTAATTTCTTTGATTTGCTTTTCAAGACCACCAACCATCTCATAA
GTGGAGTCAGGAATTTTTTCGACCATCATGAGAGAGACAAGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved