Locus Mono:snoZ30
snOPY snoRNA Orthological Gene Database
Mono:snoZ30
Mono:snoZ30
II
snoZ30
1001..1096
2095
TCAACATCGCCTTGTCGAAAAAAATGCAATGATAAAGCAGTATCAATTTCACGCTTTTT
ACTTTCAAACGATGAATGAAGCTTGATATCTTCTAAGTCAAAGTTAAATTTTTTCTCAAG
AGTTTTACCGAATCGATTTAAAGACGTGTGAAACTTCTTCTCGGTACGTTTCAGATCATC
AAAAACTTGTTGTGTTTTTTCAGAGCATGCTACCAATTCCTTCATAGATGTAGTAGGATC
TTTTAGGCAAGATTTCTTTGCATCCTTTAATATACTTTCCAATTCATTAAGCTTAGCTAA
GCATTTATTTCCAGGCGCCGTTTCTTCAATCCGCTGCCATTCGTCGATATTCATTATGTA
TAAAGAAGTTACTACGAAAAAAAATAAAAGACGAAATAGATTAAAATATTGTCCAATTCC
AACACCTTTGTTTTAAATACTCCAAGTATGGGCTTTATCGTCAAAGAAATAAATCTTCAA
TGCACGTTGCTCAGTTGATTAAAAACTATGCAAGATTGGAAAAGAAAGAATTATAATATG
AATTGAGAAGATGTTCTATAAGTATTTAAAAGCACTATTAGACACCAATTATTAAAATAA
GAGCATCCTATAGTGTGGTTTGCTCGTGCCAAGTGCTTTGTATCAGTGAGCAAATGAAGT
CACTCTGCTACATATCAGGTACCAAATTTCCCATCTACCAATATCGGCATTTAGAATTTT
TATCAACATTTCGTAATATTCTGTTAATTGCAATTAACCTGTTTCCTATTGCCAGCTGAA
CTTGTATTTCAAAATCCTATGAATCGAAACTTCAAATAACTGAAAGACTAAAACTTATCT
GTATTGGCGTTGGATTAAATCATAGTGGATGACTTTAGAAATACATGTACACTTGGTGAT
AAATAACTATAAAACCTATTTAATGATATCAAGAAAGCTTACTATCGATCAATAAACGAA
TGGCAATTGTAACCCTTTAGTTCCATAAAGTCGACCAGGAGAAGGAAATGATGAGACAAG
TTGTTCAGATCTCCGATATTAAATTGATCGGATGTTGATACCTATCTTCTTATAAGCTAA
TCTTCTCTCTGATCCTATCAAAGTAACTTTCTCGGAGAAAGGTCGAGCAATTGTAATTCA
GGTACGTTTTATTATTGAGTTCTTGAAAGTGCGGTATATTGTTTTCATATTTCCTCTATG
CTGATTGCGGAGCTAATTTAGAAAAAACTTTTTCTATGATAATGCGCCCTTTAGCTTTTT
TTGGTTTGAAGAATGTAAACGTTTTTTGAAACTCCTATACTACAAAGATTGATTTTTTTT
TATCAGTTACACTCGAACTTAAGAGTATAATTATTGGCATCAGCAAGAGATGAAACCTTG
CTTGAAACAACTTAAAAAACATCAGCTAAATCTGAATTTTTGAAAAAAAGTTTTATCCTG
TATACTATATATATATTTTTCTTTGCGGCAAGATAAGACATTTCGCCTGGTGAGCTTTCA
ATTGACTTATCTATTAATTAACTTGATTTTTGTTTGTTAGATCAAAGTATAAATTCAACT
CTCCGTAGAGTATCTGGAAAGTTAACTATTACTATTAATGATCTGAATTGACCGTGGGAT
ACAAGCCTAATAGGATAACTCGAGCTGGCATCCCAAATTTTTTGAAATCTAGTAACTCGA
GAATTCTTTCGATCTCAGCTCTTCAAAATCATTACTCTGTTTGTATTTGATAGCTTAATA
TTTATGGAAATTGAAGTTTTCAGATTTTCAGGTGTGAAAACTTTTTTTTGCGTGAGACTT
TAAATCTTTGTGCTAAATTAACTTAAGACTAATCGTATTTATTTGTAAAGAATAAAGTAA
AAACATAAAAAGTATATGAAAGACTCAAATATTCCAATTTTCCACATCCATAATCCTTTG
CTACAATTGCATGTATTTCACTAACTATCGTTATATTTTTTCGCCATGATGTTGTTTTGG
GTACGACGTTTGAAACACCGTCCTAGGGTAGGGTTTGCTAAACAGTCACACAGTATCCAA
AAAACCGTCGTGGAAAGAAACTTCTAACTTGAACAACCACCAAAAATGGTAAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved