Locus Mono:snR36
snOPY snoRNA Orthological Gene Database
Mono:snR36
Mono:snR36
II
snR36
1001..1165
2164
GAATTGAATTAGTCGATGATAATTCGCTGGTCCTACTTTGAGGAACAGAAGATGATGTC
GCTGATGGCAAGGTTGTGCTTGTAGAATTAAAAACCGCAATTACAAGATGAAAAGTGACC
AGATCAGTAGCGTCATGCAAAATTTCCTCGAGGGGAGTTTCATTCCTCAATACACGACCA
GCGTGAATCAACTTTAATCGATCTGCAGGAGCTTCAAATGTTACAGCAATCAGTTCCTTT
AATTCTAAAACCGTTTTTGTCCTAGGAACTTGAAAAATACCAACCTTCTGGTCCACAGTT
GTCACTCGAATACGATACTCTGACATTCTTTACAAGTTTCAGAATTGAAAAGGTTAAAAC
GCTTTTCAAGAGAATGTACAGCAATGTTAGGAATCACTTGAAGGAATGTTGAGCGGCACG
AATCACACGCAGTAAATAGCGTATCTCTGTACTTCACTAAATCGAGTGTGTTTTCTCACA
GTGAACATTGCCTGCTATATAGTCGTTAGAAGAAGTAAACATTCTGAAATAAAAGGGAGG
GAATCTTTTAATCTTATTCTTTCGTTCTTCTAATTGTAGGTAGTCAGAACGCTATATTGG
CTGAGAAAATCCATTCAAATTCATCCCAACACAGAGCGATCTTGACAAACTTCGCAGCAT
ACTTCCCAGGAATTCTTGTTAGAAAACAACTCATTTAAAAAGTGAATTCAAATTATTTAT
CTCATAAAATTACCGGTAGAGATAAAAAAATTAATCATACATGCAAAGTGTATTACGAAA
AATGCTGTACTTCTCAGTATTGCACTAGTGTGCTTTTATATATTCCACTGACTTGAAAAA
TTAAACTTCCACCAACTATGTGTAGCTAACAATCTTATGTTCTAATTGATAGTTTATTAA
AACTATCGTTTGGCATCTGTACAAATACAATAATATTAAATACCTTTGTTCTCAGCTCAT
TGGACCTTGTAATTATAAAAACTTGAAACGAGTAAATCTACTCTGTCTCCATCAAACTCT
CCTTATATTTTTTTATGATGAGGATTGAGTTGAGATTAGCGATATTTAATTGTATGGCTA
ATTAAATGAGACTATAAAAATCTGAGATGCCGTTGAGTACGACTACTTCAAGGTGGAGTG
GTTGTAATTTAGTGCATGTACATATTTTAATTTGTGTATTTTTCCTAACTTAATATTACA
TTGGATTATCATAATTACGTTGACGAATAGATTCATTTCTTCTCGTTTTATCCAGTCCGT
CCTTTTAATACAACAAGTTTATACCAATATGCATTGCTTGCTATATTGAAACAAAGAAAT
TCCAAGATAAAATCCCTTAAGTTTGTAGATTTCAACAAAAAGACAATGAAAATAAAATTA
AACATATGGGAAATCCACAATCTAAAATATGAGTGTTCATCTCTTTTATTAATGGGAAGA
TGGGACAACTCGACCCAAAGGTAATCCCACACGAACTTTCTGCCCTTGTTTGACCAAAAA
TTCAAAATCCGCAGGTGCTTCAAACACCAATACCACTGTACTACCAAGCTCAAAATTTCC
GACCTCATCTCCACGAAGTAATGGGTGACCATGCAAAATAGAAGAAGATGAGGTGTATAC
AGCCTCATCAAAAGTACCTACTGGGCCTAGTTTTCCAAACTGATTCGTACATAAATCTTT
ATCAAATTTAATTCGGATACTGCCAACATTTGTAGCACCGACGGGTATCATACTCATAAA
CCCGTATTTGTATCTCCCCATCAAAGCTACTCTTTCGTTCAAGATGAAAAGATTTCCGAG
TCGACGAGCCATAAAAGGAGAAACGCTAAACAGCTCTCCGGAAAAATGCCTTCTTCGTTC
TACGACCCAATCAGTCGGCGAATGAAATCGATGGTAATCACCTGGTGCCAAGTAAATAAC
TGCGTAGTATAAACAATTCGTTTCTCTTGATCCGAACAACGTAAACTGTGATTTGGCTGC
CACTTTTGTTGAGCTTAACAAATCAATATGTTGTGCGCTAGCATCTTTGACATGGCTTGG
TCGTTCACCATGATCATGACCCATTAAATCTTGTAAACTGTAATGTATACCATTTAACTT
GGCAAACTCCTCTTGACGAATGTGAGGGATATGATCGGGAGAGGGAATAGCATGGCTGCG
CTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved