Locus Mono:snR42
snOPY snoRNA Orthological Gene Database
Mono:snR42
Mono:snR42
II
snR42
1001..1209
2208
CTATCCAAAGTAGAATTCTTCAACTGAGCCTGCAGCATCTCCAACTGCTCAAGCAGCTC
GTTGTTCTCCTTCTGTAACTTTCCGATCGTATCCTGATATTGTTTTTCACGAACACGGAA
TTTGGCTTCCTCGACCGACAAAGCTGAAGTCGGCCCAGGTCTTGGTTTAATAGGTGCCTT
TCTTCTTCCCAGAGCATCTAACGCAGGTTTCCTTCCTGGTTTGGGACGAGGAGGAACAAC
CCATTGTTTAGAGACGCGAATCATCGGCTTTTGAGGTGCTGGAGAAGCAGAAGATGATTT
TTCCACTTCCGATGGACTTTTAGACGATTCCATGAGCAAAAAAAAAGTTGGGGGGATAGG
AGATATCAAGTACAGAACTACACTTTTAGCAAAATATATAAATCTTTATTTTCCAATACT
CCAATGCCTCTACTGACCAAGCTTAAAAATCTCACTTTTTCAAACGTTTGTCGTTGGTGG
TTTGTTTTAATCTGATAAAGAGATACGATTAAATTATATCTGATCTAAGTGCCGTGTGGT
TCGATGATTGTACTGTTAACCCGGTATGCAACACCTCGTTATATCTTTAAAGACTCAATT
TTCGGGAAAAAACGGATTAGTGAACAGGTCGGCTTAGAGGCGCTGTTGACATACATTCTC
AATACCCATCATTTCAGTTACAGAACCAATTAAAAAACGCGGGTATGGTGGACATCATCT
GATTAAAACCGATCGACCTAATAAACTCTGGGCTCTGGCTATGTAATACTACAATCATTC
GGCACACCAACTATCATAGTAATGCTTATCCATGTTACTTTTTTGGAGTTAAATTAATGT
TCTGACTCACTGCTTTTCTCATGTCATACCGTCCTTTGAAGATTATTTAACATTTGTTTA
TATTTTTGATATAATGAGATGAAACGAAAGTGCACTAACACATGTGACTGTTTTTTGACT
CCTAGTATATAAGAAATGTGAGTGAGTTAAAACAAAGCTTCATCTCACAAAATAATGAAT
TACTGATGTCAAAAAGTCTGCTCTCTTCTAACGCGGTTATAATATAGAACCGTATTAATG
GTTGCAGCTTTTTCCTCTTCATGGAATCGGTATAGATTATGTCGGGGAGACCGACAGCAT
AGCTTAAAACCATCGTGAAGTCGTTGCTTCGTGCCATGGCTCGTGATGACCGAATGCTAC
GTACAGTTTTTATATTTTATATCATTTTTTAGTTTGATTTATGTTGTATTCAGTTATTGT
TGTAGTTAAAATACGTTGTTTTAATAATTCACGTTGTTTCGTGCCTTCTCAATGAATATC
ATTTTTTTGTAAGCATCATATGTCTCATGTACAGTAGTGGTAAAAAGAATAAAGGTTGCT
ATGCACGCAAGGATGGAGTGAATGTATGGATACTTAGCTACTCAGTTTATCCAAATGGTT
TCGATAAAACTTCAAGCACAATCTTAAATTAAAGTTACTTTGCAAATTCATCAACGGGAT
TGCGATTGTCGTGAAAAATTTAATTGATTATTAATAATTCAATTATAAAAATATGAAACA
AAAGAGCTCGAAAAAACATTACTTATAAGAAAAATCGAAACAGCGCTAAAACATTTACTG
TAAAGCTGAGGAACACCGAAAATAGCAAAATTTAAATCTTCAAGCTACTCGTACCCTGAA
TACTCAAGGCATATATAGTACCATTAGCTGATTACAACTCTTGAACCTATCATGATGTGC
CTTGTTGTTCTTTCCCTTAAGTCTCTTTTCCCGAATTTTGTAGATCAGCAGCCTCCTCGA
TCTTTTCCTTAACATCTTTGCTGTCAACTTTTTCAGCCTTTTCATTTGCCTCTTTATTAT
CATCCTTCGCAGGCTTCTCGTTAGTGTCCTTACTGTCAGTCTGTTCGACTTTGTCCGCAG
TTTCTTTGCTATCGGTCTTTTCCTCCTTGTCATCGACCTCTATACTATCAGTCTCCTTAG
CCTTGACATCGGCCTCTTTACTTTCAGTTTCTTCGACCTTGTCCTCAGTTTCTTTGCTAT
CGGTCTTTTCATCCTTGTCATTGGCCTCTATACTATCAGTCTCCTTGGCTTTGACATCGG
TCTCCGTTTTACCAGTGTCTTCATTTGTTATCTTTGTATCTTTCTCCTCAACATCCTTAT
GAAGACTAGCTTTGTTATTTTCGTCCTTACTCTCCTTTTCTTCCCCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved