Locus rpl701
snOPY snoRNA Orthological Gene Database
rpl701
rpl701
II
snoR39b
1476..1554
3390
ATGTCTGTGCATTTAAAAGGGCTATTCAATACACTTTTATATGAAAAATCTACCGTTGC
AACAAATTATAATCTTGAGAACAAAGCTCTCCTTATACACCGATGACACTCCGTGATCGG
ACGAAAGAGTGAATTGATGAAGGACATATATCCCTTTCTAATTGGCAAAAATGATAGCTT
TAAAATAGTCCAATTAAAACTCTGTAATATTATTGTAGACTTAAAGAGCATATGTCAATT
CTTTAAAGGAACACAACTTGCAATTTCATTACACCAACACAGTGGCTCACAGGATACAAG
ACATGAAGTTCTAAATATTCAAACAATACAAATATACACAAATATAGTACTACGGAATAC
TTTTAGAAGAAAATTACAAATCCATTTTTGACTGTAGATATCCTAAACGAATAACAATTC
CAGTGAAATTCCTCCCATGTGACAGAAAAGTACCGAAATAAAATTCGAGACACTGGCAGA
TACGACAGCACACTTAAAGTCTGCGACCACGACGACCACCCTTTCTACGAGTAGAATCAG
TGGGGATGGGAGTAACATCCTCAATACGGCCAATACGCATACCAGCACGGGCCAAGGCAC
GAAGGGCAGCTTGAGCACCAGGACCAGGGGTCTTGGTAGCAGTACCACCAGTAGCACGGA
TCTTGATGTGAAGAGCAGTGATACCAACTTCCTTGCACTTAGCAGCAGCGTCTTGGGCGG
CTAACATAGCAGCGTAAGGAGAAGACTCATCACGATCAGTCTTGACCTTCATACCACCGG
TGACACGAACAATGGTTTCCTTGCCGGTCAAATCAGTGATGTGAACGAATGTATCATTAA
AGGAGGCGAAGATGTGAGCAACGCCGAAAACAAGCTCACCGGAACGGATTTGAGGGCCAA
CGTTAGTAGCCATTTTTCGTGGTTAGTTTTTGGTAACTGCGATATCTCTTTTGTTTTGGG
CTTCTTCCTGTGTAAACTAAAGGAACAGTCACAAATTTGTGTCGAAACTTTTGTGACTGC
TCATGGGAAAAGTTGACCACTAGTCTTTTCTTACCAACTTTACCACCAGACATCCACCAT
CATGGCTGTAGCATCGTCAACGGTCCCCTCAAAGGAGCAAATCTTTGCTCCTGAGTCTCT
TTTGAAGAAGAAGAAGACCCAAGAGCAGTCTCGTGAACAGCGTGTTGCTGCCGCTGCCGA
GAAGAAAGCTGTAAGTGTTTTGTCTATGGATATTTGTCTTTGGATGGATTGAATAAAGTA
CAGAAATCTTTTGAATGATGAAGAGTTTATCTATAAAGTACACTACAGATTGTGTTTTTT
CATCTAGATAGAACCCTCCCACATTCATTTTGATCGGTTTGCAAGGGTTTTCACCTCCCA
AAAATTAGTCAAACGCTTTAGCCTGTCATGGAATTTTTTATGATTGCTTTATTTTTATAA
GCAATAATAAAGCAGATAATTGAGAAATATGAAAAACAAGATGATGACAACAAATTTCGG
ATAGCTAGCTTAGGCTGTGCGCGTTCCACAATTTACCATCTTTCGGGACTGATTACTGTT
TTTCTACTTTTCTCTTTATTTATTTCTTTCCATCTAAATTACATCCATTCTAATTTCACA
AAATTTCTACTGTATTAACTGTTATGTTTAGGCTCAACAAAAGAAGCGTGAGCTCATTGC
AAAGCGCGCCGAATCTTACGATGCTGAGTACCGCAAGGCCGAACGTGAGCAAATCGAACT
CGGTCGCAAGGCTCGTGCTGAGGGCAACTACTACGTCCCTGACGAAACCAAGTTGGTCTT
TGTCATCCGTATTCGTGGTATCAACAACATTCCTCCCAAGGCCCGTAAGATCATGCAATT
ACTCCGTCTTATTCAAATCAACAACGGTGTCTTTGTTAAATTTAACAAGGCTACCAAAGA
AATGCTTCAAGTCGTTGAACCTTATGTTACTTATGGTATTCCTAACCTCAAGACTGTTCG
TGAGCTCCTTTACAAGCGTGGTTTTGGTAAGGTCAACAAACAACGCATTGCTCTTTCTGA
CAATGCTATCATCGAAGCTGCTTTGGGCAAGTACTCTATCTTGTCTATCGAGGATTTGAT
TCACGAAATTTACACCGTCGGTCCCAACTTCAAGCAAGCTGCCAACTTCATCTGGCCCTT
CCAACTTTCTTCTCCCTTGGGTGGCTGGAGAGATCGCAAGTTCAAGCATTTCATCGAAGG
TGGTGATGCTGGCAAGCGTGATGAGCATATTAACTCTCTCGTTAGAAAGATGCTTTAATT
TGGTGTAGATGTTAAAAATAACCATATCTTTCCTAGCTTTGACAAAATAATTTACAACAA
GTAGATTTAGTTGTTTTGGTCATTAGGTGTTATTAGTAAATTCATCGCTAGTAGTTACTT
TCATTGTAATTAGCTTTGTTAACTCATTTTTGCAATCTTTTGTGTGCATATAGTAATTTT
ACCTCGTCAAACAGCACTTTTACTCAACGTTGTACATAAGACGATGGTTGAACTAATGAT
GTAGTGTCTTCATTCGTAACAACTCATATTTTATAACTTACTTCCTACTAACGCGGTTTT
AATCCTAAACTTGAATAAACTAGTGGTTTGTTTAATGCAATTCATTAAAAGGACATTTCC
GCGAAGGGCCTTTGTCGATTTGCTCCTAAACCGCTTCTGCTTGCGGGAATTTGCAACCAC
GTATAGTGTTTCAGTAAGTAATGCGCGGAAATTAGTACGAAAGCGCCTTTTAATCGCTGA
TGCTTTGAAATTCAAGGAGCAAGTCAACAATCTAAATGAGTTTCGAAATAAAAAAACTAA
GTCATCCTTAATAAGAAACGATGGTTTCAAACTGGCTAAAAATGTATCTTCGTTACTTCA
AAAAGAGTCTTTAGAGAAAGCATTGCATTTACTGTACGAGAGATCAAATGCCAAGAAGAC
GGTTGCCTATAACCTTGTACTACAATATCATTTAGCTAAAGGGCATTACAACGCTGCTTG
GTCTTTGTACAATGATATGAAAAAGCGCCAACAAAAACCTAGCGATCATACATACTCCAT
TCTTCTAAAGGGATTTTGCGATGCTATTGAAAAGAATAAGCAAGGAAATTTTTCTAAACT
ACGTGAATATAGTGAAAAGGTAACAGCTAGTGCTCTCAAGGAGTCTAATAATGTCACATC
CAATTTGCATCACATACGAATTATATCCAAGTGTAGTCTAAAGCTTAAAAGTATGGTATT
GGTGTCAATGATTATTCCATCCATCAAACAAACATTGGATTTCTATAGTGGATCTCAAAT
TCTTCGACTTTTGAACGACTTTTCTATGTTCAATCCGGAACAACGTGAAGAAGTGTTAAA
GATGGGGACGAATCTTTGGAATTATTTTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1209, 1651..2390
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved