Locus gim6
snOPY snoRNA Orthological Gene Database
gim6
gim6
II
snoZ15
2069..2170
3390
TTAGTAATGATTCTTTTCATTATTTATAACGCATCTTTCTAACATAAACACAACATTCA
TGCATATGTGATACCTCATTAAGTTTTATTAAAATAAACATACCTTTTGTAACAGCATCG
TAAAGACGGTTTTTTAGCTTTAAAGCCTCTGGGCTATTTGGATCTTTGGATAACAACATA
TTGAGATAACGACGGGATTCTTCATACTGCTTCAATTTGTAATGGGACAAAGCAATGTAG
TAGAGGCATTCCAAACGCCTTTCCGGTGAATCTTTGTAAATGCTGCAGAACAAAGATAAT
CCCTGTTGTACATGCTGTGTAGAATCTGAGCGTACCAATGCCCAAGCAAGGTTAAATTTG
GTTTGTAAAGTAATCAGAGGTTGTTCTGCATCGTATTGTTCCTTGATTTGTAGAAACTCA
TCAACAGAAATAATTGAATCAATAGCAGAAGGATCAGCGAGGCGAAGGGTGTGTTTTTCA
GTCATGATGTCGTTATTGCTTCCTATATTGGTCTTTGAATGTGCCTTAATTATTTTAAAG
GCGGATTAATATAAATAAACGGAAAATGTTGAAAAAACTACAGTCACTTGAAAAAAAATT
CAACAACTCAAATATAAAAGAAGAAAAAAAGGGTTGAGTATGATGCAAAAATGCTAAATT
ATCAATGTAAACAGCCAATTCCAATTATAAAGGATTTGAGGCGCAAATGAGTGAACTACA
AGGATAATGGATTTCCAAAGCAATAGAAAAGTCCAGAAATCCGATTTAGTAAGAATATGG
ATATGCTTTTTCCACAAAAATTTGAAACAGAGAAGGAATGAAATGAAGATTCGTTTGTGA
ACGCCATCGCCAACAATTTATGTAAGGAAGAACTTAAGGATATGGCAAAACATTTCACAA
AATATTTATTACAAATTGTGGCGTATTATGTAATTCACATTTGCGAAACGTACCGATAAT
AAAAGCAGTGTAAAGTAGCTTGTAACATGCCAGCTTTGTACTTAAGGCCTAACCAACATT
TTGCCTAAGACTTGATATACTTGTAAAGGTGGTATATTCAAATATATTGAAAAAGTTCTT
GATTTGTCTATAAAAAAAGTATTAAAAGGACTATTCTTTGTACCATAATTTTGGAAAGAG
CAATTCAATCCAAAAAAAATAAGTTCTTGAGATATACCCAAGTTTCCTTTAAATAATGCA
AAATGTACGTATTTCATCATTGAGAAGAGAATTATTTTGTTAGGAATTTCCCTCTTTTTA
ACTGTGTTACATGGTAAACTAATGAGCTTTGGGCATATTAGTTAGCTAGTCAAATACAAG
AGAAAGCGGTTGATTCACAGCAACAACTGAGGACCATAATGGTACAGATTGCTGCCAAGG
AACGGGCACTAAAAATAAGTGAATTAGCCAAAAAAGAGTTAGAGGATGTTGGAGAAGATA
AGGCCGTATATACTTCTCTTGGAAAGATGTAAGTGTCATAAAATGAAACATGTATTTTTA
TTTTCTTTTCTATAAAAATAGGGAAAGAATACGGAATTAGCAAAAACAGCACTTTTGGAA
TGGAATTGACCGTACTGTCAATCTATATGTAAAGTCATTTACTAACTGTTTATTTACAGG
TTTATGAAATCCGATTTGGCTTCCGTACGTACACATTTGGACGCAGAAATGGCAAGTTTA
AGAGAAGATATTGAAGCACTACAAAAGAAACAAACATATCACGAAACAACGGCCTCAAAT
GCTGAGCAGCATTTACAAAAGATAAAAGAGTCGATTTCTTAAAACATCAATTATAATCAT
CTCATTGGTAAATTGGATTATGGGATTGGAAAGTTTATGACTTTCTTTTTTATCTTTAAA
ACTGTAGAATTAAAGTAAATTTGTTCCATTAATCTTCTTGCATTTCTAACAAATACTGGG
GCATTTGTGAGCCGAAATTTTGATCACTGTGACTGCGCTTTTGTGTATGGATACTTAAAT
TTCAAGCTTGAAGACTTGTGAATTTAGTATATGTTATACTTTTAAGGTAAGTTTTCTACT
GTTAGAATTGACGTTTGGAAAAGTAAATGGAGAAAGGATTTCTTTGATGATTCCAAAAAA
GCATAGTTCAACTGAGCATCGTATGCTGAAACTTTTTCCATCTGATTTGCACGTCAGTCT
GAGATTTCTCGTTCCCTTTTGTTTCTTTCTTTTTCAACGTCTGTTTGTCTGACTTTTGTG
TTGGCTGTTTTACTGACCCATACTTTAAGGTGTTCTATATTTTTTCAAGGATATCATTAA
CTGTGTGGAAGCTGTTTTGTTCTCCATTAACTTCTGATTTCTTTTTGAGAGATGCACAAG
GAATAGTTTATAGCTTACTTATAGTTTATGAATAAAATTATCCGAAACGAACTGTCACTA
ATCATTGTTTAACAAAGTATGTAGTAATGTATTAATATTAACTATGGCGACAATATTAGG
ACTTGAAGGTCTCTCATATCAGATGTTTGTTTCTGAATTAAAATAATAATTCTATATACG
AATTGTGAAGTTGCCGTTAAATTATGATGGTAATTTGCTGTAGTTCTAGTTAAAGTCATT
AATGTAGATCCTGCAGTTCAACTTTTTGATAAGATCTGCAGACAACTTTATATACAATAA
ATTTAGCTAAATAAAAGCAAAAAGGATTAAACACCATCGGTAAAAAAAAATAACTTTATT
AGTTTATGGTCTATTGTACCCATACACTGATCAAGAAGTAATTTAAACATATAACATAAA
TTTTCACCTATGAAAGCAGTCTAATAAACACAAAATAACATTACTAATTATATGCCAAGA
AGTTTAAAAAAAATTTAAAACAAAAAAAAAAAGAAAAACTGAACAATGGAACCTCAAATG
TCGAGACTCATGATACTAATAAAAAATTTAATACTTAATTTATAAAATAGCATAACACAC
AACCAAGGTGTTTAGATGGTTTAAAGGAAGCAAAGGTAACTAGCGTTCACAGCGCAAATA
TTGGGTTAGGGCTTGGTCATAGGAGTTAACGGCCCTATTGAAAATGCCGGTGTGGTGGTG
GAATAGGAAGACGACGCCGACTTTGTGGATGAAGAAGGAGATGGCGGTGATCCGGCCAAA
AGGTTGCTGACACTCACACGCGAAGAAGAGGAGAACTTGCGTGATCGTCGATTCGATGAT
ATACGGACTGGACCAACATTCGACTGGGATGCAGGTTTGTGAGGCATGCTGCTATTAACG
TTGGAGAGCGAGCTCAGAGAGACGGACGATGGAGTACGAGAGACAGCACCAGAGGCTGGT
GTAGACGCGGAAAAGGCGTTAGGATCACACTTCAAAGGAGGAATTAACGGAACTTGAGAA
GGTCGTAGAGAAAGCGAGCGGATAGAAGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1203, 1301..1467, 1619..2025, 2249..2390
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved