Locus gua1
snOPY snoRNA Orthological Gene Database
gua1
gua1
II
snoR54
1661..1742
4004
AATGATAAATTGTTTATGAGTAATATTATGTATTTAGTTTAACTTGATCAGCATTTTCC
ATGTTTTTCATTCGTTTTATGTCTTTCCTTAGTTATTTTATTTTATTTTATTTTTTTCGT
ATTGAATTTTTTCAATGTGAATATATTTTTAATTAATTAATTCAATTCATTATTATATAA
GAGTTGTTATTTTATCTCTTATTGTTAGTAACAATATAATATTATAAGTGCTTATGTGCA
CGTAAATAATAGTCACTTATAATTGTAACCAATGTAATCAGAATGTTCATGCAAAGAAAA
GACTCTAAATACTTTCGCATACTTACGATTTCAATAGAATTTTTGCTTAACGAATAGCGC
ATACTTGATTATGCAGCAAGGAAACCATATCACTGGTGCTCTTTTTTTTGCATTATGCAT
ACAGAGCCAATATCTCGCTAGCTACACTTTTTTTTTAAGATCGTTAAAAAAATACCTAGA
AACTGTATTGCGGTTGTCAGTAATTTAATAAAGTAGAATTGATATTCCAATTAAATGCTC
TTGCCATTGATAATTAGCTAGACGGAGCGCAACAATGGCTAAAGAAATATTTACTAGACA
AATAAATAATATATAAAATTAATTACCCCCATAAATTGGTAGTTTGACAAGCTTTTTATC
GCATAAGGTATGTGTGGACCGACAATTGCCAGGAGATGAAATCACAAAATGTTTATCTAC
GAATTTAACTGCTATGATAGGTTTGAATACGTAAAAGTAATCGCTGGAATTTTCCTTCTA
TATTTCATAGATTGTACAACATCATGGCGTTCATTCACGGCGATACAGCCATAATTCTGT
AGCATCATTTCGTGTAGGCCCATCATATAGGAAGTAATTTCCAAAGTGCGAATTTTCGTA
TCAAAACCAAGCTGCACTATACTACATAATTCAGAACAACGTGTCGCTGCACTTCCTAAA
AAATAATATATATGGAGTAGAGCGAAATTTTTTTTAATTGGTAACCACACCCCAAGCGGC
CTAAAATAGCCTAAGATGTCTGCCTTTAAGCCTTATACTGAAGCTTTGGAAGTCCTTAAG
AAGTATGAGAAGAAGGATGGATTAAGTATTGACGACTTGATTCGTCACAATTTTCAAGGT
GGATTAACCTTCAATGATTTCTTGATCTTACCAGGATACATTGACTTTGTCCCCAACAAT
GTCTCTCTTGAGACTCGTATTTCTCGTAATATTGTTCTTAAGACTCCCTTTATGAGTTCT
CCTATGGATACTGTTACTGAGGATCAAATGGCTATTTACATGGCTCTTTTGGGTGGCATT
GGTGTAATTCATCACAATTGCACTCCTGAGGAACAGGCTGCTATGGTTCGCAAGGTCAAA
AAATACGAAAATGGGTTTATTTTGGACCCTGTTGTTTTCTCTCCCCAACACACAGTTGGT
GATGTGTTGAAGATTAAAGAAACCAAAGGTTTCAGTGGTATTCCCATTACTGGTAAGTAA
ATTGATTAAGAGAAAGAGAAGAATGAAATTTTGTTGAAAGAATTACATTCATAGATGGGT
GGACTAGTGAGTCATTATTTATACTGACTCTTTCCTCTTTACTACTAATGAATGTTGCCT
ACTTTGTGATTTTTGTGGAGACTAAGCATGTACCGTTAATACCTTATGATGCTCTTTGAT
TAACTTTCGTTCTTCCGCAATGACTTAATTGTCATGGGGTCAACTTTTTTATTTTACTGA
AGATATTGTATTGCATGCTTTTTCTTTCATCTTCTTCTTGATATCGTATTCCTTATATAA
ATATGTTAGTTTACTAACCTTTAGAAAATGGAAAACTTCGTGGAAAGTTGGTTGGTATTG
TTACTTCTCGTGATGTTCAATTCCACAAAGACACCAATACTCCTGTCACTGAAGTTATGA
CCCCTCGTGAGGAATTGATCACTACCGCCGAGGGAATCAGTTTGGAGCGTGCCAACGAAA
TGTTGCGCAAATCCAAAAAGGGAAAGCTTCCTGTTGTTGACAAGGATGACAACCTGGTTG
CTCTTTTGTCTTTAACTGACTTGATGAAGAACTTGCACTTCCCTCTTGCCAGCAAAACAT
CGGATACTAAGCAACTTATGGTTGCCGCTGCTATCGGTACTCGTGATGATGACCGTACTC
GTTTGGCCTTGCTTGCTGAAGCTGGTTTAGACGCTGTTGTCATCGACTCTTCTCAGGGTA
ATTCCTGCTTCCAAATCGAAATGATTAAATGGATTAAGAAGACATATCCTAAAATTGATG
TTATTGCTGGTAATGTTGTGACTCGCGAGCAAACCGCCAGCTTAATTGCTGCTGGTGCCG
ATGGTTTACGTGTTGGTATGGGTAGTGGTAGTGCATGTATCACTCAAGAGGTTATGGCAT
GTGGTCGTCCTCAGGCTACCGCCATTGCCCAAGTTGCCGAATTTGCTAGTCAATTTGGTA
TTGGTGTCATTGCTGACGGTGGTATTCAGAACGTTGGTCATATGGTCAAGAGTCTCAGCT
TGGGTGCTACTGCTGTTATGATGGGTGGTTTGTTGGCCGGTACCACCGAATCTCCTGGTG
AATACTATGTCCGTGAGGGACAACGTTACAAATCATACCGTGGTATGGGTTCCATCGCTG
CAATGGAAGGTACTGGTGTTAATAAGAATGCTTCTACTGGCCGCTATTTCTCTGAAAACG
ATGCTGTCCGTGTTGCCCAAGGTGTCTCTGGTTTGGTCGTCGACAAGGGCTCGCTTCTTC
GCTTTTTACCTTATCTCTACACTGGTTTGCAACACGCTCTTCAAGATATTGGTACCAAAT
CTCTTGATGAGCTTCATGAAGCTGTCGACAAGCATGAAGTTCGCTTCGAGTTACGTTCGA
GCGCTGCCATCCGTGAAGGTGATATCCAAGGTTTTGCTACATACGAAAAGCGTCTTTACT
AGTCGTGTATAAGGATATTTAGGAAAAATTTAATTAAAGTTAATAAATTGCATTTATAGT
ACTTATTTTTTTTTCAAGTCAATTGTGTTTTGCTTAGGTAGAAAAAAACAAAATTATGTA
CATTGGAGGTGGCAGACATATATGTACGCTTGTATTTGATAGTGCATTACGAACGAATTG
TGCAAGTTTACTAAGAGAATTTTAGGGTTTATAAATATATAATCTAATAAGTTATTAATT
CATTAAAAATTCATATCATCAAGCTTATCCGTTTTTTTTTTTTAAATATACCCAACAGGA
TATTTAGAGGATTCGTATTTGAATATACGGACCTTTAGGTGGCTTTCTCTTCTTCGTTTT
CAGCCATGCTTAAAGATTTCCTAATAATGTTAGCTGGATTTGAAAGATGAAGAGTAGTCA
ATGAACTGAGGCTTTGTCGAGTCTTCGGTTTAGAAAAATCAAAGTTGTGAATAGCTTCAT
TGTTGAGGATGAATGTTGGTGAGTCCATATTGGCTCTGGAAAAATTCAAATCAGGAACTT
TTGGGACTGGACTACCATCCAGATCAATAGTGTCCAGATGAGGTAAAGAAACATCGTCAG
TTGACGAGTCCTCGGCCAGCAGTTGATCAAGCTGTGTGGATTCACTATTAACTTCTTGCT
TTTTCTCCAAAGGACTTTTTATCAAAAGTCCAGGTTCTGGTTTATCTTCCAACATCGGGG
AGACAGGCGAAGTAAGATTAATTTCAACATCTATCTGATTCTTATTTTCAGGCCGTTTAT
GTGCAGGAGTTGAAGGCATATGCATAGTATTAAAGAAGTTCATGTTCTTTAACTTAGAGG
TTTGAATGGGTGAGTTATACGCGGAGGCACCTGAGTCAGACGTAGACATTGAATCGTCGA
AACGAACCCTCTTTTTTGGAGAACGTTTTGAAAATACAACTGGTTTTTTTGGAGACTTCA
CGAAAAACATTCGAGGCAAGTTATTATTAAGCAAGGGTTGAGTGGGAAAACTATGAACTC
TATCACGATTGATAGTTCGTGAATCATCGGATGTTGAGTTGAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1491, 1824..3004
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved