Locus Mono:snR95
snOPY snoRNA Orthological Gene Database
Mono:snR95
Mono:snR95
II
snR95
1001..1223
2222
ATCATGGTAACTGCACAAAGTTAGATATTTGCCAAAGGGACTCCACTCAAAATCGGAAA
AGCCGACTTCAATTAACCTATTTGGTCGATATTCGTGAAAAAGAAGACCGGTGCGATGAT
AAATATAAACAACTGCATCTAATACGTTTTCCAAAACAGCTAACCAGTTTCCATCTGGCG
ACCAATGGATACCCGTCGAATCTATTGTAGGAAGCTTACACTCTTTAAGAAGTATCCATG
CCTTTTTGCTGATTTGGTAAAATTGAAGGCAATCCGAACCGTTAAAACGAGATAATATAG
TACAGAATTGCATGGATGGATGTAAAGCGTAAACTAAACAGTCAGTAAATTGATATATCA
GACAAGAAATACCTTTCGAAACATTGGTTTTTACATGTGGAAGCAAATAACCTTTCTGGG
TATTTAAAGACCACACAGTAATCTTCGACTAAAAAATTTGCTATTAGCATCGCAGATATA
TAAGCAAAAAGTTGTGCAAATTTTATTAGATACAACGTACATCAAAGGACGACCAGAGAA
GCAGTTCTCCAGACGGGCTCCAGCTGATACTACTCAAAGGATCCTGGTCGCACTGTATGC
TAGCATAATAATCGTGTTGTACAATATCTAATACAAACACTTTATCAACTGAGGCAACAC
AAATTTGATGGCATTTTTCTGCTCCTAAATTGGGTTTCCATAACAAGTATACAACCTTTT
GAATGAATTGAGCGTTTAGAAGGAACACATGGTGAAGCTCGAGGGTTTCAGAATTTCGAA
TTAAGACATGCCCAGAGCGAGATAAAGACGCAATCCAATTACCACAATGTGAAACACTTG
CAAATGTGGGATTCAGACTAGCAAACAAAGCCGTAAAATCCATCCCATAACCAAGCTTGC
AACTCTGTTTGTTGTTTGATCAGATTTATTTACAATTCGTTGTCATAGCAACGATTAGCT
TCAAATTCCATATATAAGGCGCGAGTACGCATCTTACCTTCTTTAACAACCATGTTCACT
TTCCACTTGAGAAGACACAAAAATTGTCTTGTCGCTTTAGGATAATGTGTTGACTCGCAG
GAACTAGTTGCAATGAACGGCGATTAAATTGGTCTGTTTTTTTGTTGGTTAAGCATGGTA
GATAACGTTTGTTCAAACAATAGCTTAAAGTGACATGGTTTTGCCTATGTTTATGGTAAA
AGCATCGATAGAGCTGTACATTTTTATATGCATTATGTTTAAGTGAGTTTATTTATATTT
CAAACAGGTATTATGAAGCTTACAACTTTTAATTGTAATACCTATTATGAAGTTTAATTT
AAGAGATGGCGAGTTGGCACCTGTTTTGTAAGTACTTTACTCGTTTTCTCACGTCCAATA
AACGAATATGCAGTTTTGGGTGTAATATCTTTATACCGACTTTATTTTTTTGTTTAGTCT
ATGCTAGAAAGATAATATGAAAGTAAATAAAAGATGAATAAAAGAACCATTAAATTGATA
CTGTATAAAATTTTGGATCGGCATTGTCGTGTGAAAAAAGGTTAGATCATTTGTATACTA
GTATAACTGAATAATTCTGCTTCTCAATCGTTGTGTTTGGATTCTATAGTGGCTGTTATA
AAAACTAGAGTAACTTTACCTTGGAGCTTTGAAAAATGTATTAAATCTACATATATTACT
AGACATTGGAAAACCGTTCATGGTTGTTTGAGATTGTTGTACATCAGACTGTCGTTAACG
ATTGTCGCTATCGTTAAATGTGGTCGTTAGAGAATAGAAGAGTCATTTTTGAAATGCTAA
GACATTTTAATTTAGGATGAAAATTTAGAAAGATTAATATAAACAAGCCATTAGAAGCAA
AAAATAGAATGACTGTTATCTTACAGTACGCTGAGTAATTCTGGTAAAAAAAAAAAAAAA
AAGGCCATCTTGCATTACTGATTAGAGAAAGTCATTTCGTTGAATATCAAAACGATATGA
AAAGATATGATACATTACATGTTTGGAAACTAATAAAATTATTAATATGCAAATTCCTTT
TATTTCATGATTTTGGCACTGCGTTGTTCACAAGCCTTGTGAAAGCCTCAATGCTTGGTA
TTTACCAACCTCATATCAGCGTGCGTCCAGTCATTTAATCTTGCTTTCTTTGTAATCGCG
TTCTTAATTATTATATATTAAATACTTTAGTTGACCACTTTTATTTATTTAAGATATTGA
TTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved