Locus Mono:SNORD14
snOPY snoRNA Orthological Gene Database
Mono:SNORD14
Mono:SNORD14
II
SNORD14
1001..1110
2109
TTTTAAAAGGTATATATACCGATCAGACGCCTTCATAAGCCAACGTTCTACTTCCATGA
GTCTGAAGGAGCCACATCAAATTAATATGCTAGGACGCCAAAGTAGTGGAGACAAGAGGT
TTATTGATTGATTATCTGATGTTGAAAGGCTTAGGTTCTTATCGTAAATGGCTTGTATTT
TGTGTGTTACATTTATTGATATTAGGATGGTTCTCCTTCAGGCTCTTGGAAAGCGTTCGC
CTGTATCTGTGTTGTATTTTTTGGAGAGATTCTAGTCTGATTCTAGTCGTTTGATTGTAC
AGTATGTCTGTCGTGTATGGTTGCTTTATTGTTTTTCTGGGATTAAGTCATCTTGGTGCA
GTAATTGGTACTGTGTTGGTAGAAAAACCTACCATATTCCTTTTTGCGCTTGCTGTGGTA
TCTTTTTGACTATAGTTTGAGATTAACTGGGTGTTAAAGCTTAGTAGGGGGTAAATCCCG
TACGCATACTGAAACCTTGAACTCAAACTGAATCTTTGTCGTTCTTTAAGTGCCTTGTTA
AACTTGTTTGTAAAGGTATGTTCGCCGTATGCTGATTGATGTCTGAGTACAACGAAGCTG
TTCTGATGATATTATTATGTCTTCTTTACCCGTCCTATCGACTATGACGATAACTTTGTC
TCCACTATAGGTGGAGACCATACTTGCCAGTATCTTCGATGTCTGAATTGTTTTCGTTGT
TCCAGTATCTTAGTAATCTCTGTATTGTGTATAATCTTTCAGTGTACTAACTTCTTTTTT
AGGTGTATTTGTGCGAAACTTTCAAATTTCTTGCTATGCTTAAACTCGCGAACTAAACGT
GTATGTTCTGTATGGTGAAAATAATGTGTGTTTTTCGTGTAGCTACTCCTGTACGTACGA
GTTATGGTGGAGATTGGACTTTACATCCTTTTAGTTATAAACATATATAGTGCTGTATTG
CTTTTTGGATTGTTCGGCGAAGGTTTTTTTTTGCATTGATCAACAGGTGATGAAATTTCC
ATTGAACATTCGCAGTTTCCCCGGAGCGGCATACGAACCCAATTTTGCCGCAGATGTCGT
GCATAGTCCTTCCTTTGGATGTCTGATGTTGATCTTGCAAATTTTTCCTTTTTTTTTTTT
TAATTAAATTTTTTTGTGTTGTGTTTGGCTTGTAGTTGTAGTGGTGATAAAGGTTGATTA
TCATGTTCTCCAATATAGAGTAGTTAAACTTTTTCTTGTTGTGATGGAAATTGTAGTCTG
GTTGATTTATTGAATTCAGTCTATTTAGAATTGCTTGAAAATACTCTTAATAAAATTGTT
GCAATGCGTAGAATGGCAATTAACTCTACATAGGTTAAGTAGTCTTTCTATAAAGTAAAT
AAATCATCTCTAAAAATTTGAAAGCATGTTTAGACAATATACATACAGAAACGCATCAGA
TTAACTAGAATGAAGACAAAAATATTAAACGTTTGGAAAATTATCTACAAATTAAATGCC
AGATTTATCATCCGTATTTTCTAAAGACGCATCACTGTCCCCAGTTCGATCCAATAAATT
TGAGATCTCTTTTAGAAACGAGGTTTCTGTTGTAGGAGCCAGCAAAACAGCGAGGAGAGT
TTCACTTTTGGGGAAAGAAGATAATGAAATATTTCCAGCTTCCACTAAGCTCAAAAGTCG
ACGCACCGTAGATATGCCACTCTGAATCACATAACGAAAAGGATTCGTAGTAGGATACTG
CGATGCTACACGTGATGGTGGATTAAGGGAAGGATGACCTGATAATAGTATGAGTAGGCG
TAACATGGAAACAAAAAATCCCTCGCCTATATTACACCAATTTGCCGCTTGTTCCGATTG
TTTAACATAGGAAACGGTAGCTGCTAAACAAAAAAATGACTGCTGCAATAAGGGTAACCT
TCGCTCGCATATTTTAAGGCAGTGGCGGTTAAATTTTGGGACAACAGAAGCAAGAAGTAG
AAAAAGGGAGTCTAAAAATTTTGGATTGTTATCAAAAATAGCTTGAAAGTTTGTCTTGTT
GTTAGCATCTTTGGCTAGTAATTTGGCATAGGCATTAATGGCGGGACCAGCATAGGGATG
GGTAGCAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved